EMAIL THIS PAGE TO A FRIEND

NDUFS2

NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase)

68 Gene Product Result for
Synonyms: CI-49
UniProtKB ID: O75306, D3DVG7, J3KPM7, Q5VTW0, Q969P3, Q9UEV3
Gene ID:
Human(4720) Summary: The protein encoded by this gene is a core subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (complex I). Mammalian mitochondrial complex I is composed of at least 43 different subunits, 7 of which are encoded by the mitochondrial genome, and the rest are the products of nuclear genes. The iron-sulfur protein fraction of complex I is made up of 7 subunits, including this gene product. Complex I catalyzes the NADH oxidation with concomitant ubiquinone reduction and proton ejection out of the mitochondria. Mutations in this gene are associated with mitochondrial complex I deficiency. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
Mouse(226646) NADH dehydrogenase (ubiquinone) Fe-S protein 2
Rat(289218) NADH dehydrogenase (ubiquinone) Fe-S protein 2
domestic guinea pig(100713270) NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase)
naked mole-rat(101701670) NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase)
sheep(101104108) NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase)
Zebrafish(553672) NADH dehydrogenase (ubiquinone) Fe-S protein 2
chicken(100857596) NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase)
dog(478981) NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase)
cow(327697) NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase)
domestic cat(101088298) NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153064 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153064 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153064 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004550 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004550 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004550 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004550 Rosetta Predictions human pricing
NM_001011907 Rosetta Predictions rat pricing
NM_153064 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004550 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123429 predicted 810
2 SASI_Hs01_00123431 predicted 865
3 SASI_Hs01_00123432 predicted 973
4 SASI_Hs01_00123433 predicted 1192
5 SASI_Hs02_00337866 predicted 994
6 SASI_Hs01_00123434 predicted 1571
7 SASI_Hs01_00123436 predicted 1156
8 SASI_Hs01_00123437 predicted 1245
9 SASI_Hs02_00337867 predicted 1361
10 SASI_Hs02_00337868 predicted 1391
11 SASI_Hs01_00123430 predicted 1073
12 SASI_Hs01_00123435 predicted 1647
13 SASI_Hs01_00123438 predicted 1292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011907 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069913 predicted 720
2 SASI_Rn01_00069914 predicted 1252
3 SASI_Rn01_00069915 predicted 419
4 SASI_Rn01_00069916 predicted 751
5 SASI_Rn01_00069917 predicted 1182
6 SASI_Rn01_00069918 predicted 942
7 SASI_Rn01_00069919 predicted 810
8 SASI_Rn01_00069920 predicted 1304
9 SASI_Rn01_00069921 predicted 1133
10 SASI_Rn01_00069922 predicted 918
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153064 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087006 predicted 1272
2 SASI_Mm01_00087007 predicted 438
3 SASI_Mm01_00087008 predicted 1385
4 SASI_Mm01_00087010 predicted 862
5 SASI_Mm01_00087011 predicted 825
6 SASI_Mm02_00342876 predicted 351
7 SASI_Mm02_00342877 predicted 441
8 SASI_Mm02_00342878 predicted 1385
9 SASI_Mm01_00087015 predicted 566
10 SASI_Mm02_00342879 predicted 1089
11 SASI_Mm01_00087009 predicted 1220
12 SASI_Mm01_00087012 predicted 253
13 SASI_Mm01_00087013 predicted 1208
14 SASI_Mm01_00087014 predicted 967
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153064
VALIDATED
NDUFS2 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153064.4-217s21c1
Sequence:CCGGCCTTGGAATGATGTGGACATTCTCGAGAATGTCCACATCATTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153064.4-815s21c1
Sequence:CCGGACAATAGAATCTGGCGAAATACTCGAGTATTTCGCCAGATTCTATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153064.4-1386s21c1
Sequence:CCGGGGATATTGTGTTCGGAGAAATCTCGAGATTTCTCCGAACACAATATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153064.3-1385s1c1
Sequence:CCGGCAGGATATTGTGTTCGGAGAACTCGAGTTCTCCGAACACAATATCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153064.3-813s1c1
Sequence:CCGGCCAACAATAGAATCTGGCGAACTCGAGTTCGCCAGATTCTATTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153064.3-647s1c1
Sequence:CCGGGAGAAGATGTTCGAGTTCTATCTCGAGATAGAACTCGAACATCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153064.3-1151s1c1
Sequence:CCGGGAGTCACTAATTCATCACTTTCTCGAGAAAGTGATGAATTAGTGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153064.4-1150s21c1
Sequence:CCGGGAGTCACTAATTCATCACTTTCTCGAGAAAGTGATGAATTAGTGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153064.4-646s21c1
Sequence:CCGGGAGAAGATGTTCGAGTTCTATCTCGAGATAGAACTCGAACATCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153064.3-218s1c1
Sequence:CCGGCCTTGGAATGATGTGGACATTCTCGAGAATGTCCACATCATTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153064
VALIDATED
NDUFS2 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153064.4-217s21c1
Sequence:CCGGCCTTGGAATGATGTGGACATTCTCGAGAATGTCCACATCATTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153064.4-815s21c1
Sequence:CCGGACAATAGAATCTGGCGAAATACTCGAGTATTTCGCCAGATTCTATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153064.4-1386s21c1
Sequence:CCGGGGATATTGTGTTCGGAGAAATCTCGAGATTTCTCCGAACACAATATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153064.3-1385s1c1
Sequence:CCGGCAGGATATTGTGTTCGGAGAACTCGAGTTCTCCGAACACAATATCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153064.3-813s1c1
Sequence:CCGGCCAACAATAGAATCTGGCGAACTCGAGTTCGCCAGATTCTATTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153064.3-647s1c1
Sequence:CCGGGAGAAGATGTTCGAGTTCTATCTCGAGATAGAACTCGAACATCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153064.3-1151s1c1
Sequence:CCGGGAGTCACTAATTCATCACTTTCTCGAGAAAGTGATGAATTAGTGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153064.4-1150s21c1
Sequence:CCGGGAGTCACTAATTCATCACTTTCTCGAGAAAGTGATGAATTAGTGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153064.4-646s21c1
Sequence:CCGGGAGAAGATGTTCGAGTTCTATCTCGAGATAGAACTCGAACATCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153064.3-218s1c1
Sequence:CCGGCCTTGGAATGATGTGGACATTCTCGAGAATGTCCACATCATTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153064
VALIDATED
NDUFS2 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153064.4-217s21c1
Sequence:CCGGCCTTGGAATGATGTGGACATTCTCGAGAATGTCCACATCATTCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153064.4-815s21c1
Sequence:CCGGACAATAGAATCTGGCGAAATACTCGAGTATTTCGCCAGATTCTATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153064.4-1386s21c1
Sequence:CCGGGGATATTGTGTTCGGAGAAATCTCGAGATTTCTCCGAACACAATATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153064.3-1385s1c1
Sequence:CCGGCAGGATATTGTGTTCGGAGAACTCGAGTTCTCCGAACACAATATCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153064.3-813s1c1
Sequence:CCGGCCAACAATAGAATCTGGCGAACTCGAGTTCGCCAGATTCTATTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153064.3-647s1c1
Sequence:CCGGGAGAAGATGTTCGAGTTCTATCTCGAGATAGAACTCGAACATCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153064.3-1151s1c1
Sequence:CCGGGAGTCACTAATTCATCACTTTCTCGAGAAAGTGATGAATTAGTGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153064.4-1150s21c1
Sequence:CCGGGAGTCACTAATTCATCACTTTCTCGAGAAAGTGATGAATTAGTGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153064.4-646s21c1
Sequence:CCGGGAGAAGATGTTCGAGTTCTATCTCGAGATAGAACTCGAACATCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153064.3-218s1c1
Sequence:CCGGCCTTGGAATGATGTGGACATTCTCGAGAATGTCCACATCATTCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004550
VALIDATED
NDUFS2 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307301    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004550.4-1864s21c1
Sequence:CCGGCCCTGCCTATCAGCTTCTTCTCTCGAGAGAAGAAGCTGATAGGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004550.4-1107s21c1
Sequence:CCGGCCCGAATGCATGCTGCTTATACTCGAGTATAAGCAGCATGCATTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004550.4-1480s21c1
Sequence:CCGGCGCACAGTGTCTAAACAAGATCTCGAGATCTTGTTTAGACACTGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004550.4-958s21c1
Sequence:CCGGCCGAGTGCTGTTTGGAGAAATCTCGAGATTTCTCCAAACAGCACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004550.3-596s1c1
Sequence:CCGGGCTGTTATGTACCCAAGCAAACTCGAGTTTGCTTGGGTACATAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004550.3-1107s1c1
Sequence:CCGGCCCGAATGCATGCTGCTTATACTCGAGTATAAGCAGCATGCATTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004550.3-1480s1c1
Sequence:CCGGCGCACAGTGTCTAAACAAGATCTCGAGATCTTGTTTAGACACTGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004550.3-958s1c1
Sequence:CCGGCCGAGTGCTGTTTGGAGAAATCTCGAGATTTCTCCAAACAGCACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004550.3-1781s1c1
Sequence:CCGGGCAGATGTCGTTGCCATCATACTCGAGTATGATGGCAACGACATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_004550.4-1247s21c1
Sequence:CCGGATCTGGCGAAATCGGACAATTCTCGAGAATTGTCCGATTTCGCCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004550
VALIDATED
NDUFS2 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307301    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004550.4-1864s21c1
Sequence:CCGGCCCTGCCTATCAGCTTCTTCTCTCGAGAGAAGAAGCTGATAGGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004550.4-1107s21c1
Sequence:CCGGCCCGAATGCATGCTGCTTATACTCGAGTATAAGCAGCATGCATTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004550.4-1480s21c1
Sequence:CCGGCGCACAGTGTCTAAACAAGATCTCGAGATCTTGTTTAGACACTGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004550.4-958s21c1
Sequence:CCGGCCGAGTGCTGTTTGGAGAAATCTCGAGATTTCTCCAAACAGCACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004550.3-596s1c1
Sequence:CCGGGCTGTTATGTACCCAAGCAAACTCGAGTTTGCTTGGGTACATAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004550.3-1107s1c1
Sequence:CCGGCCCGAATGCATGCTGCTTATACTCGAGTATAAGCAGCATGCATTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004550.3-1480s1c1
Sequence:CCGGCGCACAGTGTCTAAACAAGATCTCGAGATCTTGTTTAGACACTGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004550.3-958s1c1
Sequence:CCGGCCGAGTGCTGTTTGGAGAAATCTCGAGATTTCTCCAAACAGCACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004550.3-1781s1c1
Sequence:CCGGGCAGATGTCGTTGCCATCATACTCGAGTATGATGGCAACGACATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_004550.4-1247s21c1
Sequence:CCGGATCTGGCGAAATCGGACAATTCTCGAGAATTGTCCGATTTCGCCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004550
VALIDATED
NDUFS2 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307301    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004550.4-1864s21c1
Sequence:CCGGCCCTGCCTATCAGCTTCTTCTCTCGAGAGAAGAAGCTGATAGGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004550.4-1107s21c1
Sequence:CCGGCCCGAATGCATGCTGCTTATACTCGAGTATAAGCAGCATGCATTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004550.4-1480s21c1
Sequence:CCGGCGCACAGTGTCTAAACAAGATCTCGAGATCTTGTTTAGACACTGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004550.4-958s21c1
Sequence:CCGGCCGAGTGCTGTTTGGAGAAATCTCGAGATTTCTCCAAACAGCACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004550.3-596s1c1
Sequence:CCGGGCTGTTATGTACCCAAGCAAACTCGAGTTTGCTTGGGTACATAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004550.3-1107s1c1
Sequence:CCGGCCCGAATGCATGCTGCTTATACTCGAGTATAAGCAGCATGCATTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004550.3-1480s1c1
Sequence:CCGGCGCACAGTGTCTAAACAAGATCTCGAGATCTTGTTTAGACACTGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004550.3-958s1c1
Sequence:CCGGCCGAGTGCTGTTTGGAGAAATCTCGAGATTTCTCCAAACAGCACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004550.3-1781s1c1
Sequence:CCGGGCAGATGTCGTTGCCATCATACTCGAGTATGATGGCAACGACATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_004550.4-1247s21c1
Sequence:CCGGATCTGGCGAAATCGGACAATTCTCGAGAATTGTCCGATTTCGCCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)