EMAIL THIS PAGE TO A FRIEND

NDUFS3

NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)

56 Gene Product Result for
Synonyms: CI-30
UniProtKB ID: O75489, B2R9J1, Q9UNQ8
Gene ID:
Human(4722) Summary: This gene encodes one of the iron-sulfur protein (IP) components of mitochondrial NADH:ubiquinone oxidoreductase (complex I). Mutations in this gene are associated with Leigh syndrome resulting from mitochondrial complex I deficiency.[provided by RefSeq, Apr 2009]
Mouse(68349) NADH dehydrogenase (ubiquinone) Fe-S protein 3
Rat(295923) NADH dehydrogenase (ubiquinone) Fe-S protein 3
Zebrafish(550451) NADH dehydrogenase (ubiquinone) Fe-S protein 3, (NADH-coenzyme Q reductase)
cow(287327) NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)
chicken(423179) NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)
domestic cat(101096914) NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)
dog(475978) NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)
sheep(101118985) NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)
naked mole-rat(101699222) NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)
domestic guinea pig(100730807) NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004551 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004551 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004551 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026688 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026688 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026688 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004551 Rosetta Predictions human pricing
NM_001106489 Rosetta Predictions rat pricing
NM_026688 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004551 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095339 predicted 524
2 SASI_Hs01_00095340 predicted 314
3 SASI_Hs01_00095341 predicted 217
4 SASI_Hs01_00095342 predicted 619
5 SASI_Hs01_00095343 predicted 459
6 SASI_Hs02_00337869 predicted 243
7 SASI_Hs01_00095344 predicted 447
8 SASI_Hs01_00095345 predicted 585
9 SASI_Hs01_00095346 predicted 627
10 SASI_Hs01_00095347 predicted 245
11 SASI_Hs01_00095338 predicted 612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106489 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219468 predicted 359
2 SASI_Rn02_00219469 predicted 595
3 SASI_Rn02_00219470 predicted 314
4 SASI_Rn02_00219471 predicted 467
5 SASI_Rn02_00219472 predicted 795
6 SASI_Rn02_00219473 predicted 643
7 SASI_Rn02_00219474 predicted 728
8 SASI_Rn02_00219475 predicted 452
9 SASI_Rn02_00219476 predicted 457
10 SASI_Rn02_00219477 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026688 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127689 predicted 482
2 SASI_Mm01_00127690 predicted 343
3 SASI_Mm01_00127692 predicted 374
4 SASI_Mm01_00127693 predicted 329
5 SASI_Mm01_00127694 predicted 370
6 SASI_Mm01_00127695 predicted 257
7 SASI_Mm01_00127696 predicted 219
8 SASI_Mm02_00330723 predicted 536
9 SASI_Mm01_00127698 predicted 512
10 SASI_Mm02_00330724 predicted 376
11 SASI_Mm01_00127691 predicted 245
12 SASI_Mm01_00127697 predicted 532
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004551
VALIDATED
NDUFS3 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004551.1-220s1c1
Sequence:CCGGCCCAAGTATGTCCAACAAGTTCTCGAGAACTTGTTGGACATACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004551.1-436s1c1
Sequence:CCGGCGTGTGAAGACCTACACAGATCTCGAGATCTGTGTAGGTCTTCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004551.1-208s1c1
Sequence:CCGGGCTGAAATCTTGCCCAAGTATCTCGAGATACTTGGGCAAGATTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004551.1-328s1c1
Sequence:CCGGGCACAGTTCAAATCTCTGGTTCTCGAGAACCAGAGATTTGAACTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004551.1-552s1c1
Sequence:CCGGCCACCCTGATCTAAGAAGGATCTCGAGATCCTTCTTAGATCAGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004551.1-320s21c1
Sequence:GTACCGGACACCAATGCACAGTTCAAATCTCGAGATTTGAACTGTGCATTGGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004551.1-195s21c1
Sequence:CCGGTGGAGAGTATGTGGCTGAAATCTCGAGATTTCAGCCACATACTCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004551.1-546s21c1
Sequence:CCGGTGCTAACCACCCTGATCTAAGCTCGAGCTTAGATCAGGGTGGTTAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004551.1-691s21c1
Sequence:CCGGGCCCAAGAGTTCCGCAAATTTCTCGAGAAATTTGCGGAACTCTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004551.1-628s21c1
Sequence:CCGGGGCTATGTTGAGTTACGTTATCTCGAGATAACGTAACTCAACATAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004551
VALIDATED
NDUFS3 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004551.1-220s1c1
Sequence:CCGGCCCAAGTATGTCCAACAAGTTCTCGAGAACTTGTTGGACATACTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004551.1-436s1c1
Sequence:CCGGCGTGTGAAGACCTACACAGATCTCGAGATCTGTGTAGGTCTTCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004551.1-208s1c1
Sequence:CCGGGCTGAAATCTTGCCCAAGTATCTCGAGATACTTGGGCAAGATTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004551.1-328s1c1
Sequence:CCGGGCACAGTTCAAATCTCTGGTTCTCGAGAACCAGAGATTTGAACTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004551.1-552s1c1
Sequence:CCGGCCACCCTGATCTAAGAAGGATCTCGAGATCCTTCTTAGATCAGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004551.1-320s21c1
Sequence:GTACCGGACACCAATGCACAGTTCAAATCTCGAGATTTGAACTGTGCATTGGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004551.1-195s21c1
Sequence:CCGGTGGAGAGTATGTGGCTGAAATCTCGAGATTTCAGCCACATACTCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004551.1-546s21c1
Sequence:CCGGTGCTAACCACCCTGATCTAAGCTCGAGCTTAGATCAGGGTGGTTAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004551.1-691s21c1
Sequence:CCGGGCCCAAGAGTTCCGCAAATTTCTCGAGAAATTTGCGGAACTCTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004551.1-628s21c1
Sequence:CCGGGGCTATGTTGAGTTACGTTATCTCGAGATAACGTAACTCAACATAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004551
VALIDATED
NDUFS3 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004551.1-220s1c1
Sequence:CCGGCCCAAGTATGTCCAACAAGTTCTCGAGAACTTGTTGGACATACTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004551.1-436s1c1
Sequence:CCGGCGTGTGAAGACCTACACAGATCTCGAGATCTGTGTAGGTCTTCACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004551.1-208s1c1
Sequence:CCGGGCTGAAATCTTGCCCAAGTATCTCGAGATACTTGGGCAAGATTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004551.1-328s1c1
Sequence:CCGGGCACAGTTCAAATCTCTGGTTCTCGAGAACCAGAGATTTGAACTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004551.1-552s1c1
Sequence:CCGGCCACCCTGATCTAAGAAGGATCTCGAGATCCTTCTTAGATCAGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004551.1-320s21c1
Sequence:GTACCGGACACCAATGCACAGTTCAAATCTCGAGATTTGAACTGTGCATTGGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004551.1-195s21c1
Sequence:CCGGTGGAGAGTATGTGGCTGAAATCTCGAGATTTCAGCCACATACTCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004551.1-546s21c1
Sequence:CCGGTGCTAACCACCCTGATCTAAGCTCGAGCTTAGATCAGGGTGGTTAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004551.1-691s21c1
Sequence:CCGGGCCCAAGAGTTCCGCAAATTTCTCGAGAAATTTGCGGAACTCTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004551.1-628s21c1
Sequence:CCGGGGCTATGTTGAGTTACGTTATCTCGAGATAACGTAACTCAACATAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026688
VALIDATED
NDUFS3 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026688.1-475s1c1
Sequence:CCGGCTGCGGTTCAACTCTAGGATTCTCGAGAATCCTAGAGTTGAACCGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026688.2-374s1c1
Sequence:CCGGGGATCACACCAATGCACAATTCTCGAGAATTGTGCATTGGTGTGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026688.2-308s21c1
Sequence:CCGGCTGCCTTGATGAGTTAGAAATCTCGAGATTTCTAACTCATCAAGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026688.2-702s21c1
Sequence:CCGGCGTTACGACGATGAGGTAAAGCTCGAGCTTTACCTCATCGTCGTAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026688.1-640s1c1
Sequence:CCGGGATTATGGCTTCGAGGGACATCTCGAGATGTCCCTCGAAGCCATAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026688.2-519s21c1
Sequence:CCGGCTGACACCCATTGACTCTATACTCGAGTATAGAGTCAATGGGTGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026688.2-235s21c1
Sequence:CCGGACAAGCAGCTCTCAGCATTTGCTCGAGCAAATGCTGAGAGCTGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026688.2-374s21c1
Sequence:CCGGGGATCACACCAATGCACAATTCTCGAGAATTGTGCATTGGTGTGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026688
VALIDATED
NDUFS3 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026688.1-475s1c1
Sequence:CCGGCTGCGGTTCAACTCTAGGATTCTCGAGAATCCTAGAGTTGAACCGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026688.2-374s1c1
Sequence:CCGGGGATCACACCAATGCACAATTCTCGAGAATTGTGCATTGGTGTGATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026688.2-308s21c1
Sequence:CCGGCTGCCTTGATGAGTTAGAAATCTCGAGATTTCTAACTCATCAAGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026688.2-702s21c1
Sequence:CCGGCGTTACGACGATGAGGTAAAGCTCGAGCTTTACCTCATCGTCGTAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026688.1-640s1c1
Sequence:CCGGGATTATGGCTTCGAGGGACATCTCGAGATGTCCCTCGAAGCCATAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026688.2-519s21c1
Sequence:CCGGCTGACACCCATTGACTCTATACTCGAGTATAGAGTCAATGGGTGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026688.2-235s21c1
Sequence:CCGGACAAGCAGCTCTCAGCATTTGCTCGAGCAAATGCTGAGAGCTGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026688.2-374s21c1
Sequence:CCGGGGATCACACCAATGCACAATTCTCGAGAATTGTGCATTGGTGTGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026688
VALIDATED
NDUFS3 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026688.1-475s1c1
Sequence:CCGGCTGCGGTTCAACTCTAGGATTCTCGAGAATCCTAGAGTTGAACCGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026688.2-374s1c1
Sequence:CCGGGGATCACACCAATGCACAATTCTCGAGAATTGTGCATTGGTGTGATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026688.2-308s21c1
Sequence:CCGGCTGCCTTGATGAGTTAGAAATCTCGAGATTTCTAACTCATCAAGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026688.2-702s21c1
Sequence:CCGGCGTTACGACGATGAGGTAAAGCTCGAGCTTTACCTCATCGTCGTAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026688.1-640s1c1
Sequence:CCGGGATTATGGCTTCGAGGGACATCTCGAGATGTCCCTCGAAGCCATAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026688.2-519s21c1
Sequence:CCGGCTGACACCCATTGACTCTATACTCGAGTATAGAGTCAATGGGTGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026688.2-235s21c1
Sequence:CCGGACAAGCAGCTCTCAGCATTTGCTCGAGCAAATGCTGAGAGCTGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026688.2-374s21c1
Sequence:CCGGGGATCACACCAATGCACAATTCTCGAGAATTGTGCATTGGTGTGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)