EMAIL THIS PAGE TO A FRIEND

NDUFS5

NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase)

50 Gene Product Result for
Synonyms: CI-15k CI15K
UniProtKB ID: O43920
Gene ID:
Human(4725) Summary: This gene is a member of the NADH dehydrogenase (ubiquinone) iron-sulfur protein family. The encoded protein is a subunit of the NADH:ubiquinone oxidoreductase (complex I), the first enzyme complex in the electron transport chain located in the inner mitochondrial membrane. Alternative splicing results in multiple transcript variants and pseudogenes have been identified on chromosomes 1, 4 and 17. [provided by RefSeq, May 2010]
Mouse(595136) NADH dehydrogenase (ubiquinone) Fe-S protein 5
Rat(362588) NADH dehydrogenase (ubiquinone) Fe-S protein 5
Zebrafish(553660) NADH dehydrogenase (ubiquinone) Fe-S protein 5
cow(338057) NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase)
domestic cat(101094940) NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase)
dog(475322) NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase)
chicken(771510) NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase)
sheep(101118232) NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase)
naked mole-rat(101709385) NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase)
domestic guinea pig(100716506) NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004552 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004552 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004552 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001030274 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001030274 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001030274 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004552 Rosetta Predictions human pricing
NM_001030052 Rosetta Predictions rat pricing
NM_001030274 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004552 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045744 predicted 213
2 SASI_Hs01_00045751 predicted 204
3 SASI_Hs02_00337870 predicted 195
4 SASI_Hs02_00337871 predicted 111
5 SASI_Hs02_00337872 predicted 453
6 SASI_Hs02_00337873 predicted 434
7 SASI_Hs02_00337874 predicted 455
8 SASI_Hs02_00337875 predicted 193
9 SASI_Hs01_00045742 predicted 231
10 SASI_Hs01_00045743 predicted 252
11 SASI_Hs01_00045745 predicted 234
12 SASI_Hs01_00045746 predicted 249
13 SASI_Hs01_00045747 predicted 268
14 SASI_Hs01_00045748 predicted 228
15 SASI_Hs01_00045749 predicted 244
16 SASI_Hs01_00045750 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030052 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059648 predicted 233
2 SASI_Rn01_00059649 predicted 265
3 SASI_Rn01_00059650 predicted 285
4 SASI_Rn01_00059651 predicted 228
5 SASI_Rn01_00059652 predicted 256
6 SASI_Rn01_00059653 predicted 281
7 SASI_Rn01_00059654 predicted 271
8 SASI_Rn01_00059655 predicted 228
9 SASI_Rn01_00059656 predicted 262
10 SASI_Rn01_00059657 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030274 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161880 predicted 239
2 SASI_Mm01_00161881 predicted 264
3 SASI_Mm01_00161882 predicted 265
4 SASI_Mm02_00288121 predicted 266
5 SASI_Mm01_00161884 predicted 285
6 SASI_Mm01_00161885 predicted 209
7 SASI_Mm01_00161886 predicted 266
8 SASI_Mm01_00161887 predicted 243
9 SASI_Mm01_00161888 predicted 238
10 SASI_Mm01_00161889 predicted 215
11 SASI_Mm01_00161883 predicted 243
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004552
VALIDATED
NDUFS5 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004552.1-314s21c1
Sequence:CCGGGCAGCGGGATAAGCTGATAAACTCGAGTTTATCAGCTTATCCCGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004552.1-212s21c1
Sequence:CCGGCGGTTATACTCGGGCAGAGAACTCGAGTTCTCTGCCCGAGTATAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004552.1-255s21c1
Sequence:CCGGGATTTCGTAGAGTGTTTGCTTCTCGAGAAGCAAACACTCTACGAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004552.1-201s21c1
Sequence:CCGGGCACATGGAATCGGTTATACTCTCGAGAGTATAACCGATTCCATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004552.1-314s1c1
Sequence:CCGGGCAGCGGGATAAGCTGATAAACTCGAGTTTATCAGCTTATCCCGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_004552.1-255s1c1
Sequence:CCGGGATTTCGTAGAGTGTTTGCTTCTCGAGAAGCAAACACTCTACGAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004552.1-212s1c1
Sequence:CCGGCGGTTATACTCGGGCAGAGAACTCGAGTTCTCTGCCCGAGTATAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004552.1-104s1c1
Sequence:CCGGCCTTAACATAGATCGATGGTTCTCGAGAACCATCGATCTATGTTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_004552.1-201s1c1
Sequence:CCGGGCACATGGAATCGGTTATACTCTCGAGAGTATAACCGATTCCATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004552
VALIDATED
NDUFS5 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004552.1-314s21c1
Sequence:CCGGGCAGCGGGATAAGCTGATAAACTCGAGTTTATCAGCTTATCCCGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004552.1-212s21c1
Sequence:CCGGCGGTTATACTCGGGCAGAGAACTCGAGTTCTCTGCCCGAGTATAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004552.1-255s21c1
Sequence:CCGGGATTTCGTAGAGTGTTTGCTTCTCGAGAAGCAAACACTCTACGAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004552.1-201s21c1
Sequence:CCGGGCACATGGAATCGGTTATACTCTCGAGAGTATAACCGATTCCATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004552.1-314s1c1
Sequence:CCGGGCAGCGGGATAAGCTGATAAACTCGAGTTTATCAGCTTATCCCGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_004552.1-255s1c1
Sequence:CCGGGATTTCGTAGAGTGTTTGCTTCTCGAGAAGCAAACACTCTACGAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004552.1-212s1c1
Sequence:CCGGCGGTTATACTCGGGCAGAGAACTCGAGTTCTCTGCCCGAGTATAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004552.1-104s1c1
Sequence:CCGGCCTTAACATAGATCGATGGTTCTCGAGAACCATCGATCTATGTTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_004552.1-201s1c1
Sequence:CCGGGCACATGGAATCGGTTATACTCTCGAGAGTATAACCGATTCCATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004552
VALIDATED
NDUFS5 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004552.1-314s21c1
Sequence:CCGGGCAGCGGGATAAGCTGATAAACTCGAGTTTATCAGCTTATCCCGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004552.1-212s21c1
Sequence:CCGGCGGTTATACTCGGGCAGAGAACTCGAGTTCTCTGCCCGAGTATAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004552.1-255s21c1
Sequence:CCGGGATTTCGTAGAGTGTTTGCTTCTCGAGAAGCAAACACTCTACGAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004552.1-201s21c1
Sequence:CCGGGCACATGGAATCGGTTATACTCTCGAGAGTATAACCGATTCCATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004552.1-314s1c1
Sequence:CCGGGCAGCGGGATAAGCTGATAAACTCGAGTTTATCAGCTTATCCCGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_004552.1-255s1c1
Sequence:CCGGGATTTCGTAGAGTGTTTGCTTCTCGAGAAGCAAACACTCTACGAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004552.1-212s1c1
Sequence:CCGGCGGTTATACTCGGGCAGAGAACTCGAGTTCTCTGCCCGAGTATAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004552.1-104s1c1
Sequence:CCGGCCTTAACATAGATCGATGGTTCTCGAGAACCATCGATCTATGTTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_004552.1-201s1c1
Sequence:CCGGGCACATGGAATCGGTTATACTCTCGAGAGTATAACCGATTCCATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001030274
NDUFS5 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030274.1-292s21c1
Sequence:CCGGGATGAGGCGAATGCATGATATCTCGAGATATCATGCATTCGCCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030274.1-268s21c1
Sequence:CCGGAGAGTGCTTGCTTCGGTACAACTCGAGTTGTACCGAAGCAAGCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030274.1-332s21c1
Sequence:CCGGCTAATGAAAGAGGGCAAATACCTCGAGGTATTTGCCCTCTTTCATTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030274.1-244s21c1
Sequence:CCGGCAAGATAGAGTTCGATGACTTCTCGAGAAGTCATCGAACTCTATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030274.1-140s21c1
Sequence:CCGGAGCGCAGAACAGCCCTATAAGCTCGAGCTTATAGGGCTGTTCTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030274.1-269s1c1
Sequence:CCGGGAGTGCTTGCTTCGGTACAAACTCGAGTTTGTACCGAAGCAAGCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030274.1-142s1c1
Sequence:CCGGCGCAGAACAGCCCTATAAGAACTCGAGTTCTTATAGGGCTGTTCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030274.1-244s1c1
Sequence:CCGGCAAGATAGAGTTCGATGACTTCTCGAGAAGTCATCGAACTCTATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001030274
NDUFS5 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030274.1-292s21c1
Sequence:CCGGGATGAGGCGAATGCATGATATCTCGAGATATCATGCATTCGCCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030274.1-268s21c1
Sequence:CCGGAGAGTGCTTGCTTCGGTACAACTCGAGTTGTACCGAAGCAAGCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030274.1-332s21c1
Sequence:CCGGCTAATGAAAGAGGGCAAATACCTCGAGGTATTTGCCCTCTTTCATTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030274.1-244s21c1
Sequence:CCGGCAAGATAGAGTTCGATGACTTCTCGAGAAGTCATCGAACTCTATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030274.1-140s21c1
Sequence:CCGGAGCGCAGAACAGCCCTATAAGCTCGAGCTTATAGGGCTGTTCTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030274.1-269s1c1
Sequence:CCGGGAGTGCTTGCTTCGGTACAAACTCGAGTTTGTACCGAAGCAAGCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030274.1-142s1c1
Sequence:CCGGCGCAGAACAGCCCTATAAGAACTCGAGTTCTTATAGGGCTGTTCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030274.1-244s1c1
Sequence:CCGGCAAGATAGAGTTCGATGACTTCTCGAGAAGTCATCGAACTCTATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001030274
NDUFS5 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030274.1-292s21c1
Sequence:CCGGGATGAGGCGAATGCATGATATCTCGAGATATCATGCATTCGCCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030274.1-268s21c1
Sequence:CCGGAGAGTGCTTGCTTCGGTACAACTCGAGTTGTACCGAAGCAAGCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030274.1-332s21c1
Sequence:CCGGCTAATGAAAGAGGGCAAATACCTCGAGGTATTTGCCCTCTTTCATTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030274.1-244s21c1
Sequence:CCGGCAAGATAGAGTTCGATGACTTCTCGAGAAGTCATCGAACTCTATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030274.1-140s21c1
Sequence:CCGGAGCGCAGAACAGCCCTATAAGCTCGAGCTTATAGGGCTGTTCTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030274.1-269s1c1
Sequence:CCGGGAGTGCTTGCTTCGGTACAAACTCGAGTTTGTACCGAAGCAAGCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030274.1-142s1c1
Sequence:CCGGCGCAGAACAGCCCTATAAGAACTCGAGTTCTTATAGGGCTGTTCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030274.1-244s1c1
Sequence:CCGGCAAGATAGAGTTCGATGACTTCTCGAGAAGTCATCGAACTCTATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)