EMAIL THIS PAGE TO A FRIEND

NDUFS6

NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase)

41 Gene Product Result for
Synonyms: CI-13kA CI-13kD-A CI13KDA
UniProtKB ID: O75380
Gene ID:
Human(4726) Summary: This gene encodes a subunit of the NADH:ubiquinone oxidoreductase (complex I), which is the first enzyme complex in the electron transport chain of mitochondria. This complex functions in the transfer of electrons from NADH to the respiratory chain. The subunit encoded by this gene is one of seven subunits in the iron-sulfur protein fraction. Mutations in this gene cause mitochondrial complex I deficiency, a disease that causes a wide variety of clinical disorders, including neonatal disease and adult-onset neurodegenerative disorders.[provided by RefSeq, Oct 2009]
Mouse(407785) NADH dehydrogenase (ubiquinone) Fe-S protein 6
Rat(29478) NADH dehydrogenase (ubiquinone) Fe-S protein 6
Zebrafish(447913) NADH dehydrogenase (ubiquinone) Fe-S protein 6
dog(478629) NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase)
domestic cat(101101113) NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase)
cow(327691) NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase)
chicken(420976) NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase)
domestic guinea pig(100714622) NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase)
naked mole-rat(101710541) NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase)
sheep(101111395) NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010888 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010888 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010888 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004553 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004553 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004553 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004553 Rosetta Predictions human pricing
NM_019223 Rosetta Predictions rat pricing
NM_010888 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188351 predicted 297
2 SASI_Hs01_00188352 predicted 254
3 SASI_Hs01_00188353 predicted 220
4 SASI_Hs01_00188354 predicted 220
5 SASI_Hs01_00188355 predicted 216
6 SASI_Hs01_00188356 predicted 247
7 SASI_Hs01_00188357 predicted 262
8 SASI_Hs01_00188358 predicted 232
9 SASI_Hs01_00188359 predicted 250
10 SASI_Hs01_00188360 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019223 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114973 predicted 92
2 SASI_Rn01_00114974 predicted 95
3 SASI_Rn01_00114975 predicted 96
4 SASI_Rn01_00114976 predicted 210
5 SASI_Rn01_00114977 predicted 174
6 SASI_Rn01_00114978 predicted 179
7 SASI_Rn01_00114979 predicted 225
8 SASI_Rn01_00114980 predicted 180
9 SASI_Rn01_00114981 predicted 168
10 SASI_Rn01_00114982 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010888 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201795 predicted 207
2 SASI_Mm01_00201794 predicted 213
3 SASI_Mm01_00201796 predicted 223
4 SASI_Mm01_00201797 predicted 350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010888
NDUFS6 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010888.1-282s1c1
Sequence:CCGGGTACATAAACTTGGACAAAGACTCGAGTCTTTGTCCAAGTTTATGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010888.1-193s1c1
Sequence:CCGGGATTTGATAGCACAACAGCCTCTCGAGAGGCTGTTGTGCTATCAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010888.1-339s1c1
Sequence:CCGGGTTCAAGCAGCACCATCACTACTCGAGTAGTGATGGTGCTGCTTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010888.1-198s1c1
Sequence:CCGGGATAGCACAACAGCCTGTGAACTCGAGTTCACAGGCTGTTGTGCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010888
NDUFS6 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010888.1-282s1c1
Sequence:CCGGGTACATAAACTTGGACAAAGACTCGAGTCTTTGTCCAAGTTTATGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010888.1-193s1c1
Sequence:CCGGGATTTGATAGCACAACAGCCTCTCGAGAGGCTGTTGTGCTATCAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010888.1-339s1c1
Sequence:CCGGGTTCAAGCAGCACCATCACTACTCGAGTAGTGATGGTGCTGCTTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010888.1-198s1c1
Sequence:CCGGGATAGCACAACAGCCTGTGAACTCGAGTTCACAGGCTGTTGTGCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010888
NDUFS6 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010888.1-282s1c1
Sequence:CCGGGTACATAAACTTGGACAAAGACTCGAGTCTTTGTCCAAGTTTATGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010888.1-193s1c1
Sequence:CCGGGATTTGATAGCACAACAGCCTCTCGAGAGGCTGTTGTGCTATCAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010888.1-339s1c1
Sequence:CCGGGTTCAAGCAGCACCATCACTACTCGAGTAGTGATGGTGCTGCTTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010888.1-198s1c1
Sequence:CCGGGATAGCACAACAGCCTGTGAACTCGAGTTCACAGGCTGTTGTGCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004553
VALIDATED
NDUFS6 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004553.2-198s1c1
Sequence:CCGGCGTCAGAAAGAGGTGAATGAACTCGAGTTCATTCACCTCTTTCTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004553.2-149s1c1
Sequence:CCGGTGGCCAGGTTTATGATGATAACTCGAGTTATCATCATAAACCTGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004553.2-353s1c1
Sequence:CCGGCACATGCGGTTACTGTGGGCTCTCGAGAGCCCACAGTAACCGCATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004553.2-257s1c1
Sequence:CCGGCGAGGTGGAGACTCGGGTGATCTCGAGATCACCCGAGTCTCCACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004553.2-186s1c1
Sequence:CCGGCGGTTTGTAGGTCGTCAGAAACTCGAGTTTCTGACGACCTACAAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004553.3-361s21c1
Sequence:CCGGGTTACTGTGGGCTCCAGTTCACTCGAGTGAACTGGAGCCCACAGTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004553.3-164s21c1
Sequence:CCGGTGATAAAGACTACAGGAGAATCTCGAGATTCTCCTGTAGTCTTTATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004553.3-319s21c1
Sequence:CCGGTGTATATAAACTTGGACAAAGCTCGAGCTTTGTCCAAGTTTATATACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004553.3-198s21c1
Sequence:CCGGCGTCAGAAAGAGGTGAATGAACTCGAGTTCATTCACCTCTTTCTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004553.3-220s21c1
Sequence:CCGGACTTTGCCATTGATTTGATAGCTCGAGCTATCAAATCAATGGCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004553
VALIDATED
NDUFS6 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004553.2-198s1c1
Sequence:CCGGCGTCAGAAAGAGGTGAATGAACTCGAGTTCATTCACCTCTTTCTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004553.2-149s1c1
Sequence:CCGGTGGCCAGGTTTATGATGATAACTCGAGTTATCATCATAAACCTGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004553.2-353s1c1
Sequence:CCGGCACATGCGGTTACTGTGGGCTCTCGAGAGCCCACAGTAACCGCATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004553.2-257s1c1
Sequence:CCGGCGAGGTGGAGACTCGGGTGATCTCGAGATCACCCGAGTCTCCACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004553.2-186s1c1
Sequence:CCGGCGGTTTGTAGGTCGTCAGAAACTCGAGTTTCTGACGACCTACAAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004553.3-361s21c1
Sequence:CCGGGTTACTGTGGGCTCCAGTTCACTCGAGTGAACTGGAGCCCACAGTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004553.3-164s21c1
Sequence:CCGGTGATAAAGACTACAGGAGAATCTCGAGATTCTCCTGTAGTCTTTATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004553.3-319s21c1
Sequence:CCGGTGTATATAAACTTGGACAAAGCTCGAGCTTTGTCCAAGTTTATATACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004553.3-198s21c1
Sequence:CCGGCGTCAGAAAGAGGTGAATGAACTCGAGTTCATTCACCTCTTTCTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004553.3-220s21c1
Sequence:CCGGACTTTGCCATTGATTTGATAGCTCGAGCTATCAAATCAATGGCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004553
VALIDATED
NDUFS6 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004553.2-198s1c1
Sequence:CCGGCGTCAGAAAGAGGTGAATGAACTCGAGTTCATTCACCTCTTTCTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004553.2-149s1c1
Sequence:CCGGTGGCCAGGTTTATGATGATAACTCGAGTTATCATCATAAACCTGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004553.2-353s1c1
Sequence:CCGGCACATGCGGTTACTGTGGGCTCTCGAGAGCCCACAGTAACCGCATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004553.2-257s1c1
Sequence:CCGGCGAGGTGGAGACTCGGGTGATCTCGAGATCACCCGAGTCTCCACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004553.2-186s1c1
Sequence:CCGGCGGTTTGTAGGTCGTCAGAAACTCGAGTTTCTGACGACCTACAAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004553.3-361s21c1
Sequence:CCGGGTTACTGTGGGCTCCAGTTCACTCGAGTGAACTGGAGCCCACAGTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004553.3-164s21c1
Sequence:CCGGTGATAAAGACTACAGGAGAATCTCGAGATTCTCCTGTAGTCTTTATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004553.3-319s21c1
Sequence:CCGGTGTATATAAACTTGGACAAAGCTCGAGCTTTGTCCAAGTTTATATACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004553.3-198s21c1
Sequence:CCGGCGTCAGAAAGAGGTGAATGAACTCGAGTTCATTCACCTCTTTCTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004553.3-220s21c1
Sequence:CCGGACTTTGCCATTGATTTGATAGCTCGAGCTATCAAATCAATGGCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)