EMAIL THIS PAGE TO A FRIEND

NDUFS7

NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase)

62 Gene Product Result for
Synonyms: CI-20 CI-20KD MY017 PSST
UniProtKB ID: O75251, Q2T9H7, Q9BV17
Gene ID:
Human(374291) Summary: This gene encodes a protein that is a subunit of one of the complexes that forms the mitochondrial respiratory chain. This protein is one of over 40 subunits found in complex I, the nicotinamide adenine dinucleotide (NADH):ubiquinone oxidoreductase. This complex functions in the transfer of electrons from NADH to the respiratory chain, and ubiquinone is believed to be the immediate electron acceptor for the enzyme. Mutations in this gene cause Leigh syndrome due to mitochondrial complex I deficiency, a severe neurological disorder that results in bilaterally symmetrical necrotic lesions in subcortical brain regions. [provided by RefSeq, Jul 2008]
Mouse(75406) NADH dehydrogenase (ubiquinone) Fe-S protein 7
Rat(362837) NADH dehydrogenase (ubiquinone) Fe-S protein 7
Goat(100860782) NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase)
sheep(101114702) NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase)
naked mole-rat(101702397) NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase)
domestic guinea pig(100731963) NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase)
Zebrafish(796997) NADH dehydrogenase (ubiquinone) Fe-S protein 7, (NADH-coenzyme Q reductase)
dog(476754) NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase)
cow(338079) NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase)
domestic cat(101096448) NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase)
chicken(770724) NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029272 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029272 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029272 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024407 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024407 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024407 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024407 Rosetta Predictions human pricing
NM_001008525 Rosetta Predictions rat pricing
NM_029272 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219052 predicted 309
2 SASI_Hs01_00219053 predicted 408
3 SASI_Hs01_00219054 predicted 382
4 SASI_Hs01_00219055 predicted 375
5 SASI_Hs01_00219056 predicted 379
6 SASI_Hs02_00356707 predicted 294
7 SASI_Hs01_00219057 predicted 383
8 SASI_Hs01_00219059 predicted 307
9 SASI_Hs01_00219060 predicted 433
10 SASI_Hs02_00356708 predicted 293
11 SASI_Hs01_00219058 predicted 251
12 SASI_Hs01_00219061 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008525 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199215 predicted 281
2 SASI_Rn01_00070390 predicted 243
3 SASI_Rn01_00070391 predicted 240
4 SASI_Rn01_00070392 predicted 331
5 SASI_Rn01_00070393 predicted 361
6 SASI_Rn01_00070394 predicted 479
7 SASI_Rn01_00070395 predicted 482
8 SASI_Rn01_00070396 predicted 493
9 SASI_Rn01_00070397 predicted 286
10 SASI_Rn01_00070399 predicted 487
11 SASI_Rn01_00070398 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029272 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193410 predicted 274
2 SASI_Mm01_00193411 predicted 509
3 SASI_Mm01_00193412 predicted 511
4 SASI_Mm01_00193413 predicted 320
5 SASI_Mm01_00193414 predicted 532
6 SASI_Mm01_00193415 predicted 396
7 SASI_Mm01_00193416 predicted 368
8 SASI_Mm01_00193417 predicted 525
9 SASI_Mm01_00193418 predicted 409
10 SASI_Mm01_00193419 predicted 342
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029272
VALIDATED
NDUFS7 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029272.3-354s21c1
Sequence:CCGGGCGCTATGACATGGACCGCTTCTCGAGAAGCGGTCCATGTCATAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029272.3-97s21c1
Sequence:CCGGCGCAGAGTTCATCAGAGTGTACTCGAGTACACTCTGATGAACTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029272.3-538s21c1
Sequence:CCGGCACTACTCCTACTCGGTTGTTCTCGAGAACAACCGAGTAGGAGTAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029272.3-426s21c1
Sequence:CCGGTGGCACGCTTACCAACAAGATCTCGAGATCTTGTTGGTAAGCGTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029272.1-539s1c1
Sequence:CCGGCACTACTCCTACTCGGTTGTTCTCGAGAACAACCGAGTAGGAGTAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029272.1-427s1c1
Sequence:CCGGTGGCACGCTTACCAACAAGATCTCGAGATCTTGTTGGTAAGCGTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029272.1-404s1c1
Sequence:CCGGCAGGCTGATGTGATGATTGTACTCGAGTACAATCATCACATCAGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029272.1-98s1c1
Sequence:CCGGCGCAGAGTTCATCAGAGTGTACTCGAGTACACTCTGATGAACTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029272.1-355s1c1
Sequence:CCGGGCGCTATGACATGGACCGCTTCTCGAGAAGCGGTCCATGTCATAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029272
VALIDATED
NDUFS7 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029272.3-354s21c1
Sequence:CCGGGCGCTATGACATGGACCGCTTCTCGAGAAGCGGTCCATGTCATAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029272.3-97s21c1
Sequence:CCGGCGCAGAGTTCATCAGAGTGTACTCGAGTACACTCTGATGAACTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029272.3-538s21c1
Sequence:CCGGCACTACTCCTACTCGGTTGTTCTCGAGAACAACCGAGTAGGAGTAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029272.3-426s21c1
Sequence:CCGGTGGCACGCTTACCAACAAGATCTCGAGATCTTGTTGGTAAGCGTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029272.1-539s1c1
Sequence:CCGGCACTACTCCTACTCGGTTGTTCTCGAGAACAACCGAGTAGGAGTAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029272.1-427s1c1
Sequence:CCGGTGGCACGCTTACCAACAAGATCTCGAGATCTTGTTGGTAAGCGTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029272.1-404s1c1
Sequence:CCGGCAGGCTGATGTGATGATTGTACTCGAGTACAATCATCACATCAGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029272.1-98s1c1
Sequence:CCGGCGCAGAGTTCATCAGAGTGTACTCGAGTACACTCTGATGAACTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029272.1-355s1c1
Sequence:CCGGGCGCTATGACATGGACCGCTTCTCGAGAAGCGGTCCATGTCATAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029272
VALIDATED
NDUFS7 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029272.3-354s21c1
Sequence:CCGGGCGCTATGACATGGACCGCTTCTCGAGAAGCGGTCCATGTCATAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029272.3-97s21c1
Sequence:CCGGCGCAGAGTTCATCAGAGTGTACTCGAGTACACTCTGATGAACTCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029272.3-538s21c1
Sequence:CCGGCACTACTCCTACTCGGTTGTTCTCGAGAACAACCGAGTAGGAGTAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029272.3-426s21c1
Sequence:CCGGTGGCACGCTTACCAACAAGATCTCGAGATCTTGTTGGTAAGCGTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029272.1-539s1c1
Sequence:CCGGCACTACTCCTACTCGGTTGTTCTCGAGAACAACCGAGTAGGAGTAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029272.1-427s1c1
Sequence:CCGGTGGCACGCTTACCAACAAGATCTCGAGATCTTGTTGGTAAGCGTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029272.1-404s1c1
Sequence:CCGGCAGGCTGATGTGATGATTGTACTCGAGTACAATCATCACATCAGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029272.1-98s1c1
Sequence:CCGGCGCAGAGTTCATCAGAGTGTACTCGAGTACACTCTGATGAACTCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029272.1-355s1c1
Sequence:CCGGGCGCTATGACATGGACCGCTTCTCGAGAAGCGGTCCATGTCATAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024407
VALIDATED
NDUFS7 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024407.4-444s21c1
Sequence:CCGGTTCGCAAGGTCTACGACCAGACTCGAGTCTGGTCGTAGACCTTGCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024407.4-511s21c1
Sequence:CCGGAGGAGGCTACTACCACTATTCCTCGAGGAATAGTGGTAGTAGCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024407.4-412s21c1
Sequence:CCGGCGGCACACTCACCAACAAGATCTCGAGATCTTGTTGGTGAGTGTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024407.4-342s21c1
Sequence:CCGGGCTACGACATGGACCGCTTTGCTCGAGCAAAGCGGTCCATGTCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024407.4-559s21c1
Sequence:CCGGCATCGTGCCCGTGGACATCTACTCGAGTAGATGTCCACGGGCACGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024407.3-539s1c1
Sequence:CCGGCGTGCCCGTGGACATCTACATCTCGAGATGTAGATGTCCACGGGCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_024407.3-287s1c1
Sequence:CCGGCGCCGTGGAGATGATGCACATCTCGAGATGTGCATCATCTCCACGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024407.3-317s1c1
Sequence:CCGGCCGCTACGACATGGACCGCTTCTCGAGAAGCGGTCCATGTCGTAGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024407.3-422s1c1
Sequence:CCGGTCGCAAGGTCTACGACCAGATCTCGAGATCTGGTCGTAGACCTTGCGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_024407.3-487s1c1
Sequence:CCGGGAGGAGGCTACTACCACTATTCTCGAGAATAGTGGTAGTAGCCTCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024407
VALIDATED
NDUFS7 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024407.4-444s21c1
Sequence:CCGGTTCGCAAGGTCTACGACCAGACTCGAGTCTGGTCGTAGACCTTGCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024407.4-511s21c1
Sequence:CCGGAGGAGGCTACTACCACTATTCCTCGAGGAATAGTGGTAGTAGCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024407.4-412s21c1
Sequence:CCGGCGGCACACTCACCAACAAGATCTCGAGATCTTGTTGGTGAGTGTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024407.4-342s21c1
Sequence:CCGGGCTACGACATGGACCGCTTTGCTCGAGCAAAGCGGTCCATGTCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024407.4-559s21c1
Sequence:CCGGCATCGTGCCCGTGGACATCTACTCGAGTAGATGTCCACGGGCACGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024407.3-539s1c1
Sequence:CCGGCGTGCCCGTGGACATCTACATCTCGAGATGTAGATGTCCACGGGCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_024407.3-287s1c1
Sequence:CCGGCGCCGTGGAGATGATGCACATCTCGAGATGTGCATCATCTCCACGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024407.3-317s1c1
Sequence:CCGGCCGCTACGACATGGACCGCTTCTCGAGAAGCGGTCCATGTCGTAGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024407.3-422s1c1
Sequence:CCGGTCGCAAGGTCTACGACCAGATCTCGAGATCTGGTCGTAGACCTTGCGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_024407.3-487s1c1
Sequence:CCGGGAGGAGGCTACTACCACTATTCTCGAGAATAGTGGTAGTAGCCTCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024407
VALIDATED
NDUFS7 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024407.4-444s21c1
Sequence:CCGGTTCGCAAGGTCTACGACCAGACTCGAGTCTGGTCGTAGACCTTGCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024407.4-511s21c1
Sequence:CCGGAGGAGGCTACTACCACTATTCCTCGAGGAATAGTGGTAGTAGCCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024407.4-412s21c1
Sequence:CCGGCGGCACACTCACCAACAAGATCTCGAGATCTTGTTGGTGAGTGTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024407.4-342s21c1
Sequence:CCGGGCTACGACATGGACCGCTTTGCTCGAGCAAAGCGGTCCATGTCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024407.4-559s21c1
Sequence:CCGGCATCGTGCCCGTGGACATCTACTCGAGTAGATGTCCACGGGCACGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024407.3-539s1c1
Sequence:CCGGCGTGCCCGTGGACATCTACATCTCGAGATGTAGATGTCCACGGGCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_024407.3-287s1c1
Sequence:CCGGCGCCGTGGAGATGATGCACATCTCGAGATGTGCATCATCTCCACGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024407.3-317s1c1
Sequence:CCGGCCGCTACGACATGGACCGCTTCTCGAGAAGCGGTCCATGTCGTAGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024407.3-422s1c1
Sequence:CCGGTCGCAAGGTCTACGACCAGATCTCGAGATCTGGTCGTAGACCTTGCGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_024407.3-487s1c1
Sequence:CCGGGAGGAGGCTACTACCACTATTCTCGAGAATAGTGGTAGTAGCCTCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)