EMAIL THIS PAGE TO A FRIEND

NDUFV1

NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa

66 Gene Product Result for
Synonyms: CI-51K CI51KD UQOR1
Gene ID:
Human(4723) Summary: The mitochondrial respiratory chain provides energy to cells via oxidative phosphorylation and consists of four membrane-bound electron-transporting protein complexes (I-IV) and an ATP synthase (complex V). This gene encodes a 51 kDa subunit of the NADH:ubiquinone oxidoreductase complex I; a large complex with at least 45 nuclear and mitochondrial encoded subunits that liberates electrons from NADH and channels them to ubiquinone. This subunit carries the NADH-binding site as well as flavin mononucleotide (FMN)- and Fe-S-biding sites. Defects in complex I are a common cause of mitochondrial dysfunction; a syndrome that occurs in approximately 1 in 10,000 live births. Mitochondrial complex I deficiency is linked to myopathies, encephalomyopathies, and neurodegenerative disorders such as Parkinson's disease and Leigh syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2009]
Mouse(17995) NADH dehydrogenase (ubiquinone) flavoprotein 1
Rat(293655) NADH dehydrogenase (ubiquinone) flavoprotein 1
Zebrafish(445291) NADH dehydrogenase (ubiquinone) flavoprotein 1
chicken(430210) NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa
dog(476004) NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa
cow(287014) NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa
domestic cat(101093395) NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa
sheep(101121129) NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa
naked mole-rat(101726275) NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa
domestic guinea pig(100725831) NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007103 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007103 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007103 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133666 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133666 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133666 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007103 Rosetta Predictions human pricing
NM_001006972 Rosetta Predictions rat pricing
NM_133666 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007103 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064660 predicted 954
2 SASI_Hs02_00342937 predicted 216
3 SASI_Hs02_00342938 predicted 1231
4 SASI_Hs01_00064663 predicted 433
5 SASI_Hs01_00064664 predicted 1030
6 SASI_Hs01_00064665 predicted 387
7 SASI_Hs01_00064667 predicted 1281
8 SASI_Hs01_00064668 predicted 927
9 SASI_Hs01_00064669 predicted 368
10 SASI_Hs02_00342939 predicted 545
11 SASI_Hs01_00064661 predicted 1066
12 SASI_Hs01_00064662 predicted 394
13 SASI_Hs01_00064666 predicted 1227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006972 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086908 predicted 298
2 SASI_Rn02_00198529 predicted 1088
3 SASI_Rn01_00086910 predicted 635
4 SASI_Rn01_00086911 predicted 891
5 SASI_Rn01_00086912 predicted 818
6 SASI_Rn01_00086914 predicted 995
7 SASI_Rn02_00198530 predicted 875
8 SASI_Rn01_00086915 predicted 534
9 SASI_Rn01_00086916 predicted 928
10 SASI_Rn01_00086917 predicted 508
11 SASI_Rn01_00086909 predicted 527
12 SASI_Rn01_00086913 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133666 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338604 predicted 611
2 SASI_Mm01_00163335 predicted 219
3 SASI_Mm01_00163336 predicted 1179
4 SASI_Mm01_00163338 predicted 336
5 SASI_Mm01_00163339 predicted 389
6 SASI_Mm01_00163340 predicted 209
7 SASI_Mm01_00163341 predicted 1046
8 SASI_Mm01_00163342 predicted 1058
9 SASI_Mm01_00163343 predicted 900
10 SASI_Mm01_00163344 predicted 594
11 SASI_Mm01_00163337 predicted 1212
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007103
VALIDATED
NDUFV1 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007103.3-256s21c1
Sequence:CCGGCTGAAGGATGAAGACCGGATTCTCGAGAATCCGGTCTTCATCCTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007103.3-387s21c1
Sequence:CCGGCGAGATCAAGACATCGGGTTTCTCGAGAAACCCGATGTCTTGATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007103.3-1256s21c1
Sequence:CCGGCCCGCCTCATTGAGTTCTATACTCGAGTATAGAACTCAATGAGGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007103.3-1400s21c1
Sequence:CCGGGCAAGCAGATAGAAGGCCATACTCGAGTATGGCCTTCTATCTGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007103.3-688s21c1
Sequence:CCGGGCAGGTCTGATTGGCAAGAATCTCGAGATTCTTGCCAATCAGACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_007103.2-303s1c1
Sequence:CCGGCGAGATCAAGACATCGGGTTTCTCGAGAAACCCGATGTCTTGATCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007103.2-172s1c1
Sequence:CCGGCTGAAGGATGAAGACCGGATTCTCGAGAATCCGGTCTTCATCCTTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007103.2-1316s1c1
Sequence:CCGGGCAAGCAGATAGAAGGCCATACTCGAGTATGGCCTTCTATCTGCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007103.2-1172s1c1
Sequence:CCGGCCCGCCTCATTGAGTTCTATACTCGAGTATAGAACTCAATGAGGCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007103.2-604s1c1
Sequence:CCGGGCAGGTCTGATTGGCAAGAATCTCGAGATTCTTGCCAATCAGACCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007103
VALIDATED
NDUFV1 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007103.3-256s21c1
Sequence:CCGGCTGAAGGATGAAGACCGGATTCTCGAGAATCCGGTCTTCATCCTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007103.3-387s21c1
Sequence:CCGGCGAGATCAAGACATCGGGTTTCTCGAGAAACCCGATGTCTTGATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007103.3-1256s21c1
Sequence:CCGGCCCGCCTCATTGAGTTCTATACTCGAGTATAGAACTCAATGAGGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007103.3-1400s21c1
Sequence:CCGGGCAAGCAGATAGAAGGCCATACTCGAGTATGGCCTTCTATCTGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007103.3-688s21c1
Sequence:CCGGGCAGGTCTGATTGGCAAGAATCTCGAGATTCTTGCCAATCAGACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_007103.2-303s1c1
Sequence:CCGGCGAGATCAAGACATCGGGTTTCTCGAGAAACCCGATGTCTTGATCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007103.2-172s1c1
Sequence:CCGGCTGAAGGATGAAGACCGGATTCTCGAGAATCCGGTCTTCATCCTTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007103.2-1316s1c1
Sequence:CCGGGCAAGCAGATAGAAGGCCATACTCGAGTATGGCCTTCTATCTGCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007103.2-1172s1c1
Sequence:CCGGCCCGCCTCATTGAGTTCTATACTCGAGTATAGAACTCAATGAGGCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007103.2-604s1c1
Sequence:CCGGGCAGGTCTGATTGGCAAGAATCTCGAGATTCTTGCCAATCAGACCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007103
VALIDATED
NDUFV1 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007103.3-256s21c1
Sequence:CCGGCTGAAGGATGAAGACCGGATTCTCGAGAATCCGGTCTTCATCCTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007103.3-387s21c1
Sequence:CCGGCGAGATCAAGACATCGGGTTTCTCGAGAAACCCGATGTCTTGATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007103.3-1256s21c1
Sequence:CCGGCCCGCCTCATTGAGTTCTATACTCGAGTATAGAACTCAATGAGGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007103.3-1400s21c1
Sequence:CCGGGCAAGCAGATAGAAGGCCATACTCGAGTATGGCCTTCTATCTGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007103.3-688s21c1
Sequence:CCGGGCAGGTCTGATTGGCAAGAATCTCGAGATTCTTGCCAATCAGACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_007103.2-303s1c1
Sequence:CCGGCGAGATCAAGACATCGGGTTTCTCGAGAAACCCGATGTCTTGATCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007103.2-172s1c1
Sequence:CCGGCTGAAGGATGAAGACCGGATTCTCGAGAATCCGGTCTTCATCCTTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007103.2-1316s1c1
Sequence:CCGGGCAAGCAGATAGAAGGCCATACTCGAGTATGGCCTTCTATCTGCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007103.2-1172s1c1
Sequence:CCGGCCCGCCTCATTGAGTTCTATACTCGAGTATAGAACTCAATGAGGCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007103.2-604s1c1
Sequence:CCGGGCAGGTCTGATTGGCAAGAATCTCGAGATTCTTGCCAATCAGACCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133666
VALIDATED
NDUFV1 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133666.2-431s21c1
Sequence:CCGGCCCAAGTATCTGGTGGTGAATCTCGAGATTCACCACCAGATACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133666.2-1178s21c1
Sequence:CCGGCGCTCGACAGACATTGTGAAACTCGAGTTTCACAATGTCTGTCGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133666.2-220s21c1
Sequence:CCGGCCGGATCTTTACCAACCTGTACTCGAGTACAGGTTGGTAAAGATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133666.2-1157s21c1
Sequence:CCGGGCTGCAGTTATTGTTATGGATCTCGAGATCCATAACAATAACTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133666.2-734s21c1
Sequence:CCGGGCACTTATTGAATCCATTGAACTCGAGTTCAATGGATTCAATAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133666.1-431s1c1
Sequence:CCGGCCCAAGTATCTGGTGGTGAATCTCGAGATTCACCACCAGATACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133666.1-734s1c1
Sequence:CCGGGCACTTATTGAATCCATTGAACTCGAGTTCAATGGATTCAATAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133666.1-1157s1c1
Sequence:CCGGGCTGCAGTTATTGTTATGGATCTCGAGATCCATAACAATAACTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133666.1-1178s1c1
Sequence:CCGGCGCTCGACAGACATTGTGAAACTCGAGTTTCACAATGTCTGTCGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133666.1-220s1c1
Sequence:CCGGCCGGATCTTTACCAACCTGTACTCGAGTACAGGTTGGTAAAGATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133666
VALIDATED
NDUFV1 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133666.2-431s21c1
Sequence:CCGGCCCAAGTATCTGGTGGTGAATCTCGAGATTCACCACCAGATACTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133666.2-1178s21c1
Sequence:CCGGCGCTCGACAGACATTGTGAAACTCGAGTTTCACAATGTCTGTCGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133666.2-220s21c1
Sequence:CCGGCCGGATCTTTACCAACCTGTACTCGAGTACAGGTTGGTAAAGATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133666.2-1157s21c1
Sequence:CCGGGCTGCAGTTATTGTTATGGATCTCGAGATCCATAACAATAACTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133666.2-734s21c1
Sequence:CCGGGCACTTATTGAATCCATTGAACTCGAGTTCAATGGATTCAATAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133666.1-431s1c1
Sequence:CCGGCCCAAGTATCTGGTGGTGAATCTCGAGATTCACCACCAGATACTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133666.1-734s1c1
Sequence:CCGGGCACTTATTGAATCCATTGAACTCGAGTTCAATGGATTCAATAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133666.1-1157s1c1
Sequence:CCGGGCTGCAGTTATTGTTATGGATCTCGAGATCCATAACAATAACTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133666.1-1178s1c1
Sequence:CCGGCGCTCGACAGACATTGTGAAACTCGAGTTTCACAATGTCTGTCGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133666.1-220s1c1
Sequence:CCGGCCGGATCTTTACCAACCTGTACTCGAGTACAGGTTGGTAAAGATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133666
VALIDATED
NDUFV1 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133666.2-431s21c1
Sequence:CCGGCCCAAGTATCTGGTGGTGAATCTCGAGATTCACCACCAGATACTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133666.2-1178s21c1
Sequence:CCGGCGCTCGACAGACATTGTGAAACTCGAGTTTCACAATGTCTGTCGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133666.2-220s21c1
Sequence:CCGGCCGGATCTTTACCAACCTGTACTCGAGTACAGGTTGGTAAAGATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133666.2-1157s21c1
Sequence:CCGGGCTGCAGTTATTGTTATGGATCTCGAGATCCATAACAATAACTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133666.2-734s21c1
Sequence:CCGGGCACTTATTGAATCCATTGAACTCGAGTTCAATGGATTCAATAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133666.1-431s1c1
Sequence:CCGGCCCAAGTATCTGGTGGTGAATCTCGAGATTCACCACCAGATACTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133666.1-734s1c1
Sequence:CCGGGCACTTATTGAATCCATTGAACTCGAGTTCAATGGATTCAATAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133666.1-1157s1c1
Sequence:CCGGGCTGCAGTTATTGTTATGGATCTCGAGATCCATAACAATAACTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133666.1-1178s1c1
Sequence:CCGGCGCTCGACAGACATTGTGAAACTCGAGTTTCACAATGTCTGTCGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133666.1-220s1c1
Sequence:CCGGCCGGATCTTTACCAACCTGTACTCGAGTACAGGTTGGTAAAGATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)