EMAIL THIS PAGE TO A FRIEND

NDUFV2

NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa

76 Gene Product Result for
Synonyms: CI-24k
UniProtKB ID: P19404, Q9BV41
Gene ID:
Human(4729) Summary: The NADH-ubiquinone oxidoreductase complex (complex I) of the mitochondrial respiratory chain catalyzes the transfer of electrons from NADH to ubiquinone, and consists of at least 43 subunits. The complex is located in the inner mitochondrial membrane. This gene encodes the 24 kDa subunit of complex I, and is involved in electron transfer. Mutations in this gene are implicated in Parkinson's disease, bipolar disorder, schizophrenia, and have been found in one case of early onset hypertrophic cardiomyopathy and encephalopathy. A non-transcribed pseudogene of this locus is found on chromosome 19. [provided by RefSeq, Oct 2009]
Mouse(72900) NADH dehydrogenase (ubiquinone) flavoprotein 2
Rat(81728) NADH dehydrogenase (ubiquinone) flavoprotein 2
domestic guinea pig(100719197) NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa
naked mole-rat(101710102) NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa
sheep(101103690) NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa
Zebrafish(393720) NADH dehydrogenase (ubiquinone) flavoprotein 2
cow(781824) NADH dehydrogenase [ubiquinone] flavoprotein 2, mitochondrial-like
cow(282290) NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa
domestic cat(101080579) NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa
dog(480204) NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa
chicken(426488) NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021074 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021074 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021074 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028388 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028388 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028388 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021074 Rosetta Predictions human pricing
NM_031064 Rosetta Predictions rat pricing
NM_028388 Rosetta Predictions mouse pricing
XM_001004994 Rosetta Predictions mouse pricing
XM_896886 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091759 predicted 198
2 SASI_Hs01_00091761 predicted 344
3 SASI_Hs02_00354557 predicted 604
4 SASI_Hs02_00354558 predicted 228
5 SASI_Hs02_00354559 predicted 225
6 SASI_Hs02_00354560 predicted 406
7 SASI_Hs01_00091757 predicted 331
8 SASI_Hs01_00091758 predicted 447
9 SASI_Hs02_00354561 predicted 428
10 SASI_Hs01_00091760 predicted 431
11 SASI_Hs01_00091762 predicted 296
12 SASI_Hs01_00091763 predicted 575
13 SASI_Hs01_00091764 predicted 567
14 SASI_Hs01_00091765 predicted 285
15 SASI_Hs01_00091766 predicted 395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031064 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038180 predicted 459
2 SASI_Rn01_00038181 predicted 193
3 SASI_Rn01_00038182 predicted 595
4 SASI_Rn01_00038183 predicted 437
5 SASI_Rn01_00038185 predicted 250
6 SASI_Rn01_00038186 predicted 374
7 SASI_Rn01_00038187 predicted 430
8 SASI_Rn01_00038188 predicted 202
9 SASI_Rn02_00264304 predicted 557
10 SASI_Rn02_00264305 predicted 627
11 SASI_Rn01_00038179 predicted 513
12 SASI_Rn01_00038184 predicted 325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028388 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333768 predicted 291
2 SASI_Mm02_00333769 predicted 337
3 SASI_Mm02_00333770 predicted 205
4 SASI_Mm02_00333771 predicted 444
5 SASI_Mm02_00333772 predicted 760
6 SASI_Mm02_00333773 predicted 856
7 SASI_Mm02_00333774 predicted 343
8 SASI_Mm02_00333775 predicted 412
9 SASI_Mm02_00333776 predicted 196
10 SASI_Mm02_00333777 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004994 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00258158 predicted 521
2 SASI_Mm01_00258159 predicted 437
3 SASI_Mm01_00258160 predicted 543
4 SASI_Mm01_00258161 predicted 683
5 SASI_Mm01_00258162 predicted 522
6 SASI_Mm01_00258163 predicted 587
7 SASI_Mm01_00258164 predicted 654
8 SASI_Mm01_00258165 predicted 438
9 SASI_Mm01_00258166 predicted 496
10 SASI_Mm01_00258167 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896886 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205607 predicted 534
2 SASI_Mm01_00205608 predicted 450
3 SASI_Mm01_00205609 predicted 549
4 SASI_Mm01_00205610 predicted 699
5 SASI_Mm01_00205611 predicted 536
6 SASI_Mm01_00205612 predicted 611
7 SASI_Mm01_00205613 predicted 668
8 SASI_Mm01_00205614 predicted 455
9 SASI_Mm01_00205615 predicted 519
10 SASI_Mm01_00205616 predicted 442
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021074
VALIDATED
NDUFV2 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021074.2-335s21c1
Sequence:CCGGAGTACCTCCAATGAGAGTATACTCGAGTATACTCTCATTGGAGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021074.2-563s21c1
Sequence:CCGGCGCACCAATGGTTCAAATAAACTCGAGTTTATTTGAACCATTGGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021074.2-223s21c1
Sequence:CCGGACTATCCAGAAGGCCATAAAGCTCGAGCTTTATGGCCTTCTGGATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_021074.1-594s1c1
Sequence:CCGGCTATGAGGATTTGACAGCTAACTCGAGTTAGCTGTCAAATCCTCATAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021074.1-527s1c1
Sequence:CCGGCTCTTATAGAAGTGGAATGTTCTCGAGAACATTCCACTTCTATAAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_021074.1-394s1c1
Sequence:CCGGCCAGTTGGAAAGTATCACATTCTCGAGAATGTGATACTTTCCAACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021074.2-114s21c1
Sequence:CCGGGGAGCTGGAGGAGCTTTATTTCTCGAGAAATAAAGCTCCTCCAGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021074.2-394s21c1
Sequence:CCGGCAGTTGGAAAGTATCACATTCCTCGAGGAATGTGATACTTTCCAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_021074.1-172s1c1
Sequence:CCGGCCATTTGATTTCACACCAGAACTCGAGTTCTGGTGTGAAATCAAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_021074.1-340s1c1
Sequence:CCGGCCTCCAATGAGAGTATATGAACTCGAGTTCATATACTCTCATTGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021074
VALIDATED
NDUFV2 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021074.2-335s21c1
Sequence:CCGGAGTACCTCCAATGAGAGTATACTCGAGTATACTCTCATTGGAGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021074.2-563s21c1
Sequence:CCGGCGCACCAATGGTTCAAATAAACTCGAGTTTATTTGAACCATTGGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021074.2-223s21c1
Sequence:CCGGACTATCCAGAAGGCCATAAAGCTCGAGCTTTATGGCCTTCTGGATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_021074.1-594s1c1
Sequence:CCGGCTATGAGGATTTGACAGCTAACTCGAGTTAGCTGTCAAATCCTCATAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021074.1-527s1c1
Sequence:CCGGCTCTTATAGAAGTGGAATGTTCTCGAGAACATTCCACTTCTATAAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_021074.1-394s1c1
Sequence:CCGGCCAGTTGGAAAGTATCACATTCTCGAGAATGTGATACTTTCCAACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021074.2-114s21c1
Sequence:CCGGGGAGCTGGAGGAGCTTTATTTCTCGAGAAATAAAGCTCCTCCAGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021074.2-394s21c1
Sequence:CCGGCAGTTGGAAAGTATCACATTCCTCGAGGAATGTGATACTTTCCAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_021074.1-172s1c1
Sequence:CCGGCCATTTGATTTCACACCAGAACTCGAGTTCTGGTGTGAAATCAAATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_021074.1-340s1c1
Sequence:CCGGCCTCCAATGAGAGTATATGAACTCGAGTTCATATACTCTCATTGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021074
VALIDATED
NDUFV2 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021074.2-335s21c1
Sequence:CCGGAGTACCTCCAATGAGAGTATACTCGAGTATACTCTCATTGGAGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021074.2-563s21c1
Sequence:CCGGCGCACCAATGGTTCAAATAAACTCGAGTTTATTTGAACCATTGGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021074.2-223s21c1
Sequence:CCGGACTATCCAGAAGGCCATAAAGCTCGAGCTTTATGGCCTTCTGGATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_021074.1-594s1c1
Sequence:CCGGCTATGAGGATTTGACAGCTAACTCGAGTTAGCTGTCAAATCCTCATAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021074.1-527s1c1
Sequence:CCGGCTCTTATAGAAGTGGAATGTTCTCGAGAACATTCCACTTCTATAAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_021074.1-394s1c1
Sequence:CCGGCCAGTTGGAAAGTATCACATTCTCGAGAATGTGATACTTTCCAACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021074.2-114s21c1
Sequence:CCGGGGAGCTGGAGGAGCTTTATTTCTCGAGAAATAAAGCTCCTCCAGCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021074.2-394s21c1
Sequence:CCGGCAGTTGGAAAGTATCACATTCCTCGAGGAATGTGATACTTTCCAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_021074.1-172s1c1
Sequence:CCGGCCATTTGATTTCACACCAGAACTCGAGTTCTGGTGTGAAATCAAATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_021074.1-340s1c1
Sequence:CCGGCCTCCAATGAGAGTATATGAACTCGAGTTCATATACTCTCATTGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028388
VALIDATED
NDUFV2 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000225973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028388.2-398s21c1
Sequence:CCGGGCCAGTTGGGAAGTACCATATCTCGAGATATGGTACTTCCCAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028388.2-450s21c1
Sequence:CCGGCGAGATTCTGACAGCATATTGCTCGAGCAATATGCTGTCAGAATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028388.2-937s21c1
Sequence:CCGGACCTGTGAAGACCTATCATTACTCGAGTAATGATAGGTCTTCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028388.2-569s21c1
Sequence:GTACCGGTGCACCGATGGTTCAAATAAACTCGAGTTTATTTGAACCATCGGTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028388
VALIDATED
NDUFV2 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000225973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028388.2-398s21c1
Sequence:CCGGGCCAGTTGGGAAGTACCATATCTCGAGATATGGTACTTCCCAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028388.2-450s21c1
Sequence:CCGGCGAGATTCTGACAGCATATTGCTCGAGCAATATGCTGTCAGAATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028388.2-937s21c1
Sequence:CCGGACCTGTGAAGACCTATCATTACTCGAGTAATGATAGGTCTTCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028388.2-569s21c1
Sequence:GTACCGGTGCACCGATGGTTCAAATAAACTCGAGTTTATTTGAACCATCGGTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028388
VALIDATED
NDUFV2 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000225973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028388.2-398s21c1
Sequence:CCGGGCCAGTTGGGAAGTACCATATCTCGAGATATGGTACTTCCCAACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028388.2-450s21c1
Sequence:CCGGCGAGATTCTGACAGCATATTGCTCGAGCAATATGCTGTCAGAATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028388.2-937s21c1
Sequence:CCGGACCTGTGAAGACCTATCATTACTCGAGTAATGATAGGTCTTCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028388.2-569s21c1
Sequence:GTACCGGTGCACCGATGGTTCAAATAAACTCGAGTTTATTTGAACCATCGGTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)