EMAIL THIS PAGE TO A FRIEND

NDUFV3

NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa

90 Gene Product Result for
Synonyms: CI-10k CI-9KD
UniProtKB ID: P56181, A8K0M1, J3KNX7, Q6FGD3, Q8WU60, Q9HCR5
Gene ID:
Human(4731) Summary: The protein encoded by this gene is one of at least forty-one subunits that make up the NADH-ubiquinone oxidoreductase complex. This complex is part of the mitochondrial respiratory chain and serves to catalyze the rotenone-sensitive oxidation of NADH and the reduction of ubiquinone. The encoded protein is one of three proteins found in the flavoprotein fraction of the complex. The specific function of the encoded protein is unknown. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(78330) NADH dehydrogenase (ubiquinone) flavoprotein 3
Rat(64539) NADH dehydrogenase (ubiquinone) flavoprotein 3
Zebrafish(797946) NADH dehydrogenase (ubiquinone) flavoprotein 3
chicken(418541) NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa
domestic cat(101084817) NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa
cow(327717) NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa
dog(478421) NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa
sheep(101105620) NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa
naked mole-rat(101706205) NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa
domestic guinea pig(100734603) NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021075 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021075 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021075 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030087 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030087 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030087 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU089681 MISSION® esiRNA esiRNA targeting mouse Ndufv3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001503 Rosetta Predictions human pricing
NM_021075 Rosetta Predictions human pricing
NM_001101011 Rosetta Predictions rat pricing
NM_022607 Rosetta Predictions rat pricing
NM_001083891 Rosetta Predictions mouse pricing
NM_030087 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303800 predicted 152
2 SASI_Hs02_00303801 predicted 140
3 SASI_Hs02_00303802 predicted 131
4 SASI_Hs01_00044865 predicted 825
5 SASI_Hs01_00044866 predicted 258
6 SASI_Hs01_00044867 predicted 104
7 SASI_Hs01_00044868 predicted 168
8 SASI_Hs01_00044870 predicted 295
9 SASI_Hs01_00044872 predicted 316
10 SASI_Hs02_00303803 predicted 298
11 SASI_Hs01_00044864 predicted 253
12 SASI_Hs01_00044869 predicted 834
13 SASI_Hs01_00044871 predicted 161
14 SASI_Hs01_00044873 predicted 835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021075 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113517 predicted 813
2 SASI_Hs01_00113518 predicted 1352
3 SASI_Hs01_00113519 predicted 417
4 SASI_Hs01_00113520 predicted 326
5 SASI_Hs01_00113521 predicted 912
6 SASI_Hs01_00113522 predicted 1178
7 SASI_Hs01_00113523 predicted 1391
8 SASI_Hs01_00113524 predicted 151
9 SASI_Hs01_00113525 predicted 799
10 SASI_Hs01_00113526 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101011 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211236 predicted 218
2 SASI_Rn02_00211237 predicted 230
3 SASI_Rn02_00211238 predicted 259
4 SASI_Rn02_00211239 predicted 219
5 SASI_Rn02_00211240 predicted 216
6 SASI_Rn02_00211241 predicted 263
7 SASI_Rn02_00211242 predicted 218
8 SASI_Rn02_00211243 predicted 218
9 SASI_Rn02_00211244 predicted 233
10 SASI_Rn02_00211245 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022607 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263362 predicted 483
2 SASI_Rn01_00037328 predicted 742
3 SASI_Rn01_00037331 predicted 1146
4 SASI_Rn01_00037332 predicted 930
5 SASI_Rn02_00263363 predicted 776
6 SASI_Rn02_00263364 predicted 887
7 SASI_Rn01_00037333 predicted 553
8 SASI_Rn01_00037334 predicted 620
9 SASI_Rn01_00037335 predicted 1155
10 SASI_Rn02_00263365 predicted 749
11 SASI_Rn01_00037329 predicted 713
12 SASI_Rn01_00037330 predicted 958
13 SASI_Rn01_00037336 predicted 274
14 SASI_Rn01_00037337 predicted 339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083891 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299861 predicted 237
2 SASI_Mm02_00299862 predicted 231
3 SASI_Mm02_00299863 predicted 250
4 SASI_Mm02_00299864 predicted 220
5 SASI_Mm02_00299865 predicted 197
6 SASI_Mm02_00299866 predicted 230
7 SASI_Mm02_00299867 predicted 198
8 SASI_Mm02_00299868 predicted 255
9 SASI_Mm02_00299869 predicted 224
10 SASI_Mm02_00299870 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030087 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336483 predicted 451
2 SASI_Mm01_00126244 predicted 532
3 SASI_Mm01_00126245 predicted 1080
4 SASI_Mm02_00336484 predicted 936
5 SASI_Mm01_00126246 predicted 540
6 SASI_Mm01_00126247 predicted 905
7 SASI_Mm01_00126249 predicted 412
8 SASI_Mm02_00336485 predicted 341
9 SASI_Mm02_00336486 predicted 739
10 SASI_Mm02_00336487 predicted 764
11 SASI_Mm01_00126243 predicted 903
12 SASI_Mm01_00126248 predicted 1254
13 SASI_Mm01_00126250 predicted 392
14 SASI_Mm01_00126251 predicted 884
15 SASI_Mm01_00126252 predicted 1200
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021075
NDUFV3 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021075.2-875s1c1
Sequence:CCGGAGAAAGACTTTGGTAGAGTTTCTCGAGAAACTCTACCAAAGTCTTTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021075.2-993s1c1
Sequence:CCGGCCAGCTCCTCTGATTCTGAATCTCGAGATTCAGAATCAGAGGAGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021075.2-603s1c1
Sequence:CCGGGACTTGCTTCTACGGTTTCTTCTCGAGAAGAAACCGTAGAAGCAAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021075.2-1119s1c1
Sequence:CCGGCCCGAGTTACAGTATCAGCAACTCGAGTTGCTGATACTGTAACTCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021075.2-1810s1c1
Sequence:CCGGGCCGTTTGACAACACTACCTACTCGAGTAGGTAGTGTTGTCAAACGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021075.3-1209s21c1
Sequence:CCGGGACAGTTCCTGTTGAGAATAACTCGAGTTATTCTCAACAGGAACTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021075.3-280s21c1
Sequence:CCGGACAGCAGCTGAATTGTCTAAACTCGAGTTTAGACAATTCAGCTGCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021075.3-1574s21c1
Sequence:CCGGCCGCTGTGCATAATCGGTTTCCTCGAGGAAACCGATTATGCACAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021075.3-1172s21c1
Sequence:CCGGCAATCGTGGAAGATCAGATACCTCGAGGTATCTGATCTTCCACGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021075
NDUFV3 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021075.2-875s1c1
Sequence:CCGGAGAAAGACTTTGGTAGAGTTTCTCGAGAAACTCTACCAAAGTCTTTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021075.2-993s1c1
Sequence:CCGGCCAGCTCCTCTGATTCTGAATCTCGAGATTCAGAATCAGAGGAGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021075.2-603s1c1
Sequence:CCGGGACTTGCTTCTACGGTTTCTTCTCGAGAAGAAACCGTAGAAGCAAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021075.2-1119s1c1
Sequence:CCGGCCCGAGTTACAGTATCAGCAACTCGAGTTGCTGATACTGTAACTCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021075.2-1810s1c1
Sequence:CCGGGCCGTTTGACAACACTACCTACTCGAGTAGGTAGTGTTGTCAAACGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021075.3-1209s21c1
Sequence:CCGGGACAGTTCCTGTTGAGAATAACTCGAGTTATTCTCAACAGGAACTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021075.3-280s21c1
Sequence:CCGGACAGCAGCTGAATTGTCTAAACTCGAGTTTAGACAATTCAGCTGCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021075.3-1574s21c1
Sequence:CCGGCCGCTGTGCATAATCGGTTTCCTCGAGGAAACCGATTATGCACAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021075.3-1172s21c1
Sequence:CCGGCAATCGTGGAAGATCAGATACCTCGAGGTATCTGATCTTCCACGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021075
NDUFV3 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021075.2-875s1c1
Sequence:CCGGAGAAAGACTTTGGTAGAGTTTCTCGAGAAACTCTACCAAAGTCTTTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021075.2-993s1c1
Sequence:CCGGCCAGCTCCTCTGATTCTGAATCTCGAGATTCAGAATCAGAGGAGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021075.2-603s1c1
Sequence:CCGGGACTTGCTTCTACGGTTTCTTCTCGAGAAGAAACCGTAGAAGCAAGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021075.2-1119s1c1
Sequence:CCGGCCCGAGTTACAGTATCAGCAACTCGAGTTGCTGATACTGTAACTCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021075.2-1810s1c1
Sequence:CCGGGCCGTTTGACAACACTACCTACTCGAGTAGGTAGTGTTGTCAAACGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021075.3-1209s21c1
Sequence:CCGGGACAGTTCCTGTTGAGAATAACTCGAGTTATTCTCAACAGGAACTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021075.3-280s21c1
Sequence:CCGGACAGCAGCTGAATTGTCTAAACTCGAGTTTAGACAATTCAGCTGCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021075.3-1574s21c1
Sequence:CCGGCCGCTGTGCATAATCGGTTTCCTCGAGGAAACCGATTATGCACAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021075.3-1172s21c1
Sequence:CCGGCAATCGTGGAAGATCAGATACCTCGAGGTATCTGATCTTCCACGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030087
NDUFV3 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030087.1-902s1c1
Sequence:CCGGGCCATGTGAAGCTGAAGTAATCTCGAGATTACTTCAGCTTCACATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030087.1-502s1c1
Sequence:CCGGCAAACGATTCATCTTCATCTTCTCGAGAAGATGAAGATGAATCGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030087.1-901s1c1
Sequence:CCGGAGCCATGTGAAGCTGAAGTAACTCGAGTTACTTCAGCTTCACATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030087.1-488s1c1
Sequence:CCGGCGTGCAGAAAGTGACAAACGACTCGAGTCGTTTGTCACTTTCTGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030087.2-947s21c1
Sequence:CCGGGTGAAGCTGAAGGAATCTTACCTCGAGGTAAGATTCCTTCAGCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030087.2-1012s21c1
Sequence:CCGGCCAGTGCCCACAACGCAAATACTCGAGTATTTGCGTTGTGGGCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030087.2-529s21c1
Sequence:CCGGCACGTGCAGAAAGTGACAAACCTCGAGGTTTGTCACTTTCTGCACGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030087.2-1206s21c1
Sequence:CCGGTCAGAAACCAGTGAGCTATTCCTCGAGGAATAGCTCACTGGTTTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030087.2-426s21c1
Sequence:CCGGTGAAGGGCTTCCGAAGCATTTCTCGAGAAATGCTTCGGAAGCCCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030087
NDUFV3 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030087.1-902s1c1
Sequence:CCGGGCCATGTGAAGCTGAAGTAATCTCGAGATTACTTCAGCTTCACATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030087.1-502s1c1
Sequence:CCGGCAAACGATTCATCTTCATCTTCTCGAGAAGATGAAGATGAATCGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030087.1-901s1c1
Sequence:CCGGAGCCATGTGAAGCTGAAGTAACTCGAGTTACTTCAGCTTCACATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030087.1-488s1c1
Sequence:CCGGCGTGCAGAAAGTGACAAACGACTCGAGTCGTTTGTCACTTTCTGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030087.2-947s21c1
Sequence:CCGGGTGAAGCTGAAGGAATCTTACCTCGAGGTAAGATTCCTTCAGCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030087.2-1012s21c1
Sequence:CCGGCCAGTGCCCACAACGCAAATACTCGAGTATTTGCGTTGTGGGCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030087.2-529s21c1
Sequence:CCGGCACGTGCAGAAAGTGACAAACCTCGAGGTTTGTCACTTTCTGCACGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030087.2-1206s21c1
Sequence:CCGGTCAGAAACCAGTGAGCTATTCCTCGAGGAATAGCTCACTGGTTTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030087.2-426s21c1
Sequence:CCGGTGAAGGGCTTCCGAAGCATTTCTCGAGAAATGCTTCGGAAGCCCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030087
NDUFV3 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030087.1-902s1c1
Sequence:CCGGGCCATGTGAAGCTGAAGTAATCTCGAGATTACTTCAGCTTCACATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030087.1-502s1c1
Sequence:CCGGCAAACGATTCATCTTCATCTTCTCGAGAAGATGAAGATGAATCGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030087.1-901s1c1
Sequence:CCGGAGCCATGTGAAGCTGAAGTAACTCGAGTTACTTCAGCTTCACATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030087.1-488s1c1
Sequence:CCGGCGTGCAGAAAGTGACAAACGACTCGAGTCGTTTGTCACTTTCTGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030087.2-947s21c1
Sequence:CCGGGTGAAGCTGAAGGAATCTTACCTCGAGGTAAGATTCCTTCAGCTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030087.2-1012s21c1
Sequence:CCGGCCAGTGCCCACAACGCAAATACTCGAGTATTTGCGTTGTGGGCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030087.2-529s21c1
Sequence:CCGGCACGTGCAGAAAGTGACAAACCTCGAGGTTTGTCACTTTCTGCACGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030087.2-1206s21c1
Sequence:CCGGTCAGAAACCAGTGAGCTATTCCTCGAGGAATAGCTCACTGGTTTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030087.2-426s21c1
Sequence:CCGGTGAAGGGCTTCCGAAGCATTTCTCGAGAAATGCTTCGGAAGCCCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)