EMAIL THIS PAGE TO A FRIEND

NEB

nebulin

62 Gene Product Result for
Synonyms: NEB177D NEM2
UniProtKB ID: P20929, Q15346, Q53QQ2, Q53TG8
Gene ID:
Human(4703) Summary: This gene encodes nebulin, a giant protein component of the cytoskeletal matrix that coexists with the thick and thin filaments within the sarcomeres of skeletal muscle. In most vertebrates, nebulin accounts for 3 to 4% of the total myofibrillar protein. The encoded protein contains approximately 30-amino acid long modules that can be classified into 7 types and other repeated modules. Protein isoform sizes vary from 600 to 800 kD due to alternative splicing that is tissue-, species-,and developmental stage-specific. Of the 183 exons in the nebulin gene, at least 43 are alternatively spliced, although exons 143 and 144 are not found in the same transcript. Of the several thousand transcript variants predicted for nebulin, the RefSeq Project has decided to create three representative RefSeq records. Mutations in this gene are associated with recessive nemaline myopathy. [provided by RefSeq, Sep 2009]
Mouse(17996) nebulin
Rat(311029) nebulin
cow(407121) nebulin
dog(476149) nebulin
chicken(374027) nebulin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004543 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004543 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004543 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010889 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010889 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010889 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005401 MISSION® esiRNA esiRNA targeting human NEB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004543 Rosetta Predictions human pricing
NM_001107731 Rosetta Predictions rat pricing
NM_010889 Rosetta Predictions mouse pricing
XM_130232 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004543 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091777 predicted 12490
2 SASI_Hs02_00337854 predicted 9325
3 SASI_Hs01_00091779 predicted 14690
4 SASI_Hs01_00091780 predicted 2910
5 SASI_Hs01_00091782 predicted 766
6 SASI_Hs01_00091783 predicted 7485
7 SASI_Hs02_00337855 predicted 1950
8 SASI_Hs01_00091784 predicted 2477
9 SASI_Hs02_00337856 predicted 7758
10 SASI_Hs01_00091778 predicted 16754
11 SASI_Hs01_00091781 predicted 785
12 SASI_Hs01_00091785 predicted 8340
13 SASI_Hs01_00091786 predicted 10646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107731 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231715 predicted 14892
2 SASI_Rn02_00231716 predicted 13835
3 SASI_Rn02_00231717 predicted 474
4 SASI_Rn02_00231718 predicted 16756
5 SASI_Rn02_00231719 predicted 18556
6 SASI_Rn02_00231720 predicted 12639
7 SASI_Rn02_00231721 predicted 13146
8 SASI_Rn02_00231722 predicted 21630
9 SASI_Rn02_00231723 predicted 9855
10 SASI_Rn02_00231724 predicted 17073
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010889 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319584 predicted 789
2 SASI_Mm02_00319585 predicted 6455
3 SASI_Mm02_00319586 predicted 16464
4 SASI_Mm02_00319587 predicted 11621
5 SASI_Mm02_00319588 predicted 1823
6 SASI_Mm02_00319589 predicted 14092
7 SASI_Mm02_00319590 predicted 10164
8 SASI_Mm02_00319591 predicted 21336
9 SASI_Mm02_00319592 predicted 1054
10 SASI_Mm02_00319593 predicted 11642
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130232 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252514 predicted 6465
2 SASI_Mm01_00252515 predicted 15016
3 SASI_Mm01_00252516 predicted 10895
4 SASI_Mm01_00252517 predicted 8706
5 SASI_Mm01_00252518 predicted 1821
6 SASI_Mm01_00252519 predicted 12640
7 SASI_Mm01_00252520 predicted 19880
8 SASI_Mm01_00252521 predicted 1068
9 SASI_Mm01_00252522 predicted 10910
10 SASI_Mm01_00252523 predicted 3980
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004543
NEB MISSION shRNA Bacterial Glycerol Stock
nebulin
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004543.2-5963s1c1
Sequence:CCGGCCGGGAATACAAGAAGGGATACTCGAGTATCCCTTCTTGTATTCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004543.2-2796s1c1
Sequence:CCGGGCCTATAATCTGAGTGATAATCTCGAGATTATCACTCAGATTATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004543.2-12813s1c1
Sequence:CCGGGCGGACATCTTCAGTGAGAAACTCGAGTTTCTCACTGAAGATGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004543.2-20617s1c1
Sequence:CCGGGCCTAGAGTCTTTCTCCATTACTCGAGTAATGGAGAAAGACTCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004543.2-17770s1c1
Sequence:CCGGGCCAGGTTAAATACCGAGAAACTCGAGTTTCTCGGTATTTAACCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004543
NEB MISSION shRNA shRNA Plasmid DNA
nebulin
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004543.2-5963s1c1
Sequence:CCGGCCGGGAATACAAGAAGGGATACTCGAGTATCCCTTCTTGTATTCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004543.2-2796s1c1
Sequence:CCGGGCCTATAATCTGAGTGATAATCTCGAGATTATCACTCAGATTATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004543.2-12813s1c1
Sequence:CCGGGCGGACATCTTCAGTGAGAAACTCGAGTTTCTCACTGAAGATGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004543.2-20617s1c1
Sequence:CCGGGCCTAGAGTCTTTCTCCATTACTCGAGTAATGGAGAAAGACTCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004543.2-17770s1c1
Sequence:CCGGGCCAGGTTAAATACCGAGAAACTCGAGTTTCTCGGTATTTAACCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004543
NEB MISSION shRNA Lentiviral Transduction Particles
nebulin
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004543.2-5963s1c1
Sequence:CCGGCCGGGAATACAAGAAGGGATACTCGAGTATCCCTTCTTGTATTCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004543.2-2796s1c1
Sequence:CCGGGCCTATAATCTGAGTGATAATCTCGAGATTATCACTCAGATTATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004543.2-12813s1c1
Sequence:CCGGGCGGACATCTTCAGTGAGAAACTCGAGTTTCTCACTGAAGATGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004543.2-20617s1c1
Sequence:CCGGGCCTAGAGTCTTTCTCCATTACTCGAGTAATGGAGAAAGACTCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004543.2-17770s1c1
Sequence:CCGGGCCAGGTTAAATACCGAGAAACTCGAGTTTCTCGGTATTTAACCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010889
NEB MISSION shRNA Bacterial Glycerol Stock
nebulin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010889.1-22285s21c1
Sequence:CCGGACCAGTCCTTCCCAATTATAACTCGAGTTATAATTGGGAAGGACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010889.1-7156s21c1
Sequence:CCGGTGCCGGATACACCAGATATTTCTCGAGAAATATCTGGTGTATCCGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010889.1-1386s21c1
Sequence:CCGGACCGAAACACCTGAGTATAAACTCGAGTTTATACTCAGGTGTTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010889.1-9073s21c1
Sequence:CCGGATGATCTCCAGAGCGATAATACTCGAGTATTATCGCTCTGGAGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010889.1-13367s21c1
Sequence:CCGGCGACGTTGATTATCGCAATTACTCGAGTAATTGCGATAATCAACGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010889
NEB MISSION shRNA shRNA Plasmid DNA
nebulin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010889.1-22285s21c1
Sequence:CCGGACCAGTCCTTCCCAATTATAACTCGAGTTATAATTGGGAAGGACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010889.1-7156s21c1
Sequence:CCGGTGCCGGATACACCAGATATTTCTCGAGAAATATCTGGTGTATCCGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010889.1-1386s21c1
Sequence:CCGGACCGAAACACCTGAGTATAAACTCGAGTTTATACTCAGGTGTTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010889.1-9073s21c1
Sequence:CCGGATGATCTCCAGAGCGATAATACTCGAGTATTATCGCTCTGGAGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010889.1-13367s21c1
Sequence:CCGGCGACGTTGATTATCGCAATTACTCGAGTAATTGCGATAATCAACGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010889
NEB MISSION shRNA Lentiviral Transduction Particles
nebulin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010889.1-22285s21c1
Sequence:CCGGACCAGTCCTTCCCAATTATAACTCGAGTTATAATTGGGAAGGACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010889.1-7156s21c1
Sequence:CCGGTGCCGGATACACCAGATATTTCTCGAGAAATATCTGGTGTATCCGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010889.1-1386s21c1
Sequence:CCGGACCGAAACACCTGAGTATAAACTCGAGTTTATACTCAGGTGTTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010889.1-9073s21c1
Sequence:CCGGATGATCTCCAGAGCGATAATACTCGAGTATTATCGCTCTGGAGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010889.1-13367s21c1
Sequence:CCGGCGACGTTGATTATCGCAATTACTCGAGTAATTGCGATAATCAACGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)