EMAIL THIS PAGE TO A FRIEND

NEBL

nebulette

308 Gene Product Result for
Synonyms: LASP2 LNEBL
UniProtKB ID: O76041, B0YJ45, Q2TBD0, Q70I54, Q9UIC4
Gene ID:
Human(10529) Summary: This gene encodes a nebulin like protein that is abundantly expressed in cardiac muscle. The encoded protein binds actin and interacts with thin filaments and Z-line associated proteins in striated muscle. This protein may be involved in cardiac myofibril assembly. A shorter isoform of this protein termed LIM nebulette is expressed in non-muscle cells and may function as a component of focal adhesion complexes. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Mouse(74103) nebulette
Rat(307189) nebulette
Zebrafish(541446) nebulette
cow(517987) nebulette
Horse(100055848) nebulette
dog(477974) nebulette
chicken(395148) nebulette
sheep(101102163) nebulette
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028757 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028757 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028757 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006393 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006393 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006393 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065011 MISSION® esiRNA esiRNA human NEBL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006393 Rosetta Predictions human pricing
NM_213569 Rosetta Predictions human pricing
XM_001068639 Rosetta Predictions rat pricing
XM_225644 Rosetta Predictions rat pricing
NM_028757 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006393 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195263 predicted 1532
2 SASI_Hs01_00195264 predicted 1748
3 SASI_Hs01_00195265 predicted 1019
4 SASI_Hs01_00195266 predicted 999
5 SASI_Hs01_00195267 predicted 2914
6 SASI_Hs01_00195268 predicted 2405
7 SASI_Hs02_00341469 predicted 1195
8 SASI_Hs01_00195270 predicted 2969
9 SASI_Hs01_00195271 predicted 3095
10 SASI_Hs02_00341470 predicted 2782
11 SASI_Hs01_00195269 predicted 2587
12 SASI_Hs01_00195272 predicted 3249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040079 predicted 1009
2 SASI_Hs01_00040081 predicted 806
3 SASI_Hs01_00040082 predicted 966
4 SASI_Hs01_00040083 predicted 852
5 SASI_Hs01_00040084 predicted 936
6 SASI_Hs02_00374259 predicted 592
7 SASI_Hs02_00374260 predicted 687
8 SASI_Hs01_00040085 predicted 989
9 SASI_Hs01_00040086 predicted 908
10 SASI_Hs01_00040087 predicted 674
11 SASI_Hs01_00040080 predicted 903
12 SASI_Hs01_00040088 predicted 748
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068639 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325266 predicted 2265
2 SASI_Rn02_00325267 predicted 1268
3 SASI_Rn02_00325268 predicted 621
4 SASI_Rn02_00325269 predicted 2837
5 SASI_Rn02_00325270 predicted 3029
6 SASI_Rn02_00325271 predicted 1522
7 SASI_Rn02_00325272 predicted 291
8 SASI_Rn02_00325273 predicted 2527
9 SASI_Rn02_00325274 predicted 655
10 SASI_Rn02_00325275 predicted 2926
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225644 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382994 predicted 2257
2 SASI_Rn02_00382995 predicted 1266
3 SASI_Rn02_00382996 predicted 622
4 SASI_Rn02_00382997 predicted 2838
5 SASI_Rn02_00382998 predicted 3022
6 SASI_Rn02_00382999 predicted 1522
7 SASI_Rn02_00383000 predicted 290
8 SASI_Rn02_00383001 predicted 2533
9 SASI_Rn02_00383002 predicted 662
10 SASI_Rn02_00383003 predicted 2923
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028757 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334338 predicted 1090
2 SASI_Mm01_00036204 predicted 1052
3 SASI_Mm01_00036205 predicted 328
4 SASI_Mm01_00036206 predicted 252
5 SASI_Mm01_00036208 predicted 992
6 SASI_Mm01_00036209 predicted 261
7 SASI_Mm01_00036210 predicted 930
8 SASI_Mm01_00036211 predicted 310
9 SASI_Mm01_00036212 predicted 620
10 SASI_Mm01_00036213 predicted 899
11 SASI_Mm01_00036207 predicted 1097
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028757
NEBL MISSION shRNA Bacterial Glycerol Stock
nebulette
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028757.1-333s1c1
Sequence:CCGGACAACTACAAAGGCTATGAAACTCGAGTTTCATAGCCTTTGTAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028757.1-1596s1c1
Sequence:CCGGCGGGAGCTATTTAGTTCTCATCTCGAGATGAGAACTAAATAGCTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028757.1-992s1c1
Sequence:CCGGCCAGCAAATTACATTGAGTTTCTCGAGAAACTCAATGTAATTTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028757.1-277s1c1
Sequence:CCGGGTATTGGCATAAAGGATGTTTCTCGAGAAACATCCTTTATGCCAATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028757.1-553s1c1
Sequence:CCGGGCAGATCAGTAATGTCAAATACTCGAGTATTTGACATTACTGATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028757
NEBL MISSION shRNA shRNA Plasmid DNA
nebulette
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028757.1-333s1c1
Sequence:CCGGACAACTACAAAGGCTATGAAACTCGAGTTTCATAGCCTTTGTAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028757.1-1596s1c1
Sequence:CCGGCGGGAGCTATTTAGTTCTCATCTCGAGATGAGAACTAAATAGCTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028757.1-992s1c1
Sequence:CCGGCCAGCAAATTACATTGAGTTTCTCGAGAAACTCAATGTAATTTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028757.1-277s1c1
Sequence:CCGGGTATTGGCATAAAGGATGTTTCTCGAGAAACATCCTTTATGCCAATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028757.1-553s1c1
Sequence:CCGGGCAGATCAGTAATGTCAAATACTCGAGTATTTGACATTACTGATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028757
NEBL MISSION shRNA Lentiviral Transduction Particles
nebulette
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028757.1-333s1c1
Sequence:CCGGACAACTACAAAGGCTATGAAACTCGAGTTTCATAGCCTTTGTAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028757.1-1596s1c1
Sequence:CCGGCGGGAGCTATTTAGTTCTCATCTCGAGATGAGAACTAAATAGCTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028757.1-992s1c1
Sequence:CCGGCCAGCAAATTACATTGAGTTTCTCGAGAAACTCAATGTAATTTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028757.1-277s1c1
Sequence:CCGGGTATTGGCATAAAGGATGTTTCTCGAGAAACATCCTTTATGCCAATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028757.1-553s1c1
Sequence:CCGGGCAGATCAGTAATGTCAAATACTCGAGTATTTGACATTACTGATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006393
NEBL MISSION shRNA Bacterial Glycerol Stock
nebulette
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006393.2-541s21c1
Sequence:CCGGCATTAGCGATATCCGTTATAACTCGAGTTATAACGGATATCGCTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006393.2-601s21c1
Sequence:CCGGGACTGACAGTCCTATGCTAAACTCGAGTTTAGCATAGGACTGTCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006393.2-1362s21c1
Sequence:CCGGTGGAACATCTGCACCATAAAGCTCGAGCTTTATGGTGCAGATGTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006393.2-1838s21c1
Sequence:CCGGGCGAGTGAGAAAGACTATAAACTCGAGTTTATAGTCTTTCTCACTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006393.1-2116s1c1
Sequence:CCGGCATAGCAGATACTCCTGAAATCTCGAGATTTCAGGAGTATCTGCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006393.1-2115s1c1
Sequence:CCGGCCATAGCAGATACTCCTGAAACTCGAGTTTCAGGAGTATCTGCTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006393.2-3403s21c1
Sequence:CCGGAGGAATGCTCCCAGCGAATTACTCGAGTAATTCGCTGGGAGCATTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006393.2-3044s21c1
Sequence:CCGGTCCCATTCCAGCAGTACTTTCCTCGAGGAAAGTACTGCTGGAATGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006393.2-2351s21c1
Sequence:CCGGATCAGCAATCTCCAGTATAAACTCGAGTTTATACTGGAGATTGCTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006393.1-681s1c1
Sequence:CCGGCTGACCTTTCTAATTCTCTTTCTCGAGAAAGAGAATTAGAAAGGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006393.1-7020s1c1
Sequence:CCGGCCTCAGATATTAAAGGTGTTACTCGAGTAACACCTTTAATATCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006393
NEBL MISSION shRNA shRNA Plasmid DNA
nebulette
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006393.2-541s21c1
Sequence:CCGGCATTAGCGATATCCGTTATAACTCGAGTTATAACGGATATCGCTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006393.2-601s21c1
Sequence:CCGGGACTGACAGTCCTATGCTAAACTCGAGTTTAGCATAGGACTGTCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006393.2-1362s21c1
Sequence:CCGGTGGAACATCTGCACCATAAAGCTCGAGCTTTATGGTGCAGATGTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006393.2-1838s21c1
Sequence:CCGGGCGAGTGAGAAAGACTATAAACTCGAGTTTATAGTCTTTCTCACTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006393.1-2116s1c1
Sequence:CCGGCATAGCAGATACTCCTGAAATCTCGAGATTTCAGGAGTATCTGCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006393.1-2115s1c1
Sequence:CCGGCCATAGCAGATACTCCTGAAACTCGAGTTTCAGGAGTATCTGCTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006393.2-3403s21c1
Sequence:CCGGAGGAATGCTCCCAGCGAATTACTCGAGTAATTCGCTGGGAGCATTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006393.2-3044s21c1
Sequence:CCGGTCCCATTCCAGCAGTACTTTCCTCGAGGAAAGTACTGCTGGAATGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006393.2-2351s21c1
Sequence:CCGGATCAGCAATCTCCAGTATAAACTCGAGTTTATACTGGAGATTGCTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006393.1-681s1c1
Sequence:CCGGCTGACCTTTCTAATTCTCTTTCTCGAGAAAGAGAATTAGAAAGGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006393.1-7020s1c1
Sequence:CCGGCCTCAGATATTAAAGGTGTTACTCGAGTAACACCTTTAATATCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006393
NEBL MISSION shRNA Lentiviral Transduction Particles
nebulette
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006393.2-541s21c1
Sequence:CCGGCATTAGCGATATCCGTTATAACTCGAGTTATAACGGATATCGCTAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006393.2-601s21c1
Sequence:CCGGGACTGACAGTCCTATGCTAAACTCGAGTTTAGCATAGGACTGTCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006393.2-1362s21c1
Sequence:CCGGTGGAACATCTGCACCATAAAGCTCGAGCTTTATGGTGCAGATGTTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006393.2-1838s21c1
Sequence:CCGGGCGAGTGAGAAAGACTATAAACTCGAGTTTATAGTCTTTCTCACTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006393.1-2116s1c1
Sequence:CCGGCATAGCAGATACTCCTGAAATCTCGAGATTTCAGGAGTATCTGCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006393.1-2115s1c1
Sequence:CCGGCCATAGCAGATACTCCTGAAACTCGAGTTTCAGGAGTATCTGCTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006393.2-3403s21c1
Sequence:CCGGAGGAATGCTCCCAGCGAATTACTCGAGTAATTCGCTGGGAGCATTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006393.2-3044s21c1
Sequence:CCGGTCCCATTCCAGCAGTACTTTCCTCGAGGAAAGTACTGCTGGAATGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006393.2-2351s21c1
Sequence:CCGGATCAGCAATCTCCAGTATAAACTCGAGTTTATACTGGAGATTGCTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006393.1-681s1c1
Sequence:CCGGCTGACCTTTCTAATTCTCTTTCTCGAGAAAGAGAATTAGAAAGGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006393.1-7020s1c1
Sequence:CCGGCCTCAGATATTAAAGGTGTTACTCGAGTAACACCTTTAATATCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)