EMAIL THIS PAGE TO A FRIEND

NECAB1

N-terminal EF-hand calcium binding protein 1

98 Gene Product Result for
Synonyms: EFCBP1 STIP-1
UniProtKB ID: Q8N987, Q6NUS7, Q96AZ7, Q9HBW8
Gene ID:
Mouse(69352) N-terminal EF-hand calcium binding protein 1
Rat(64169) N-terminal EF-hand calcium binding protein 1
Zebrafish(550546) N-terminal EF-hand calcium binding protein 1
domestic cat(101101108) N-terminal EF-hand calcium binding protein 1
dog(611356) N-terminal EF-hand calcium binding protein 1
chicken(420219) N-terminal EF-hand calcium binding protein 1
domestic guinea pig(100714270) N-terminal EF-hand calcium binding protein 1
naked mole-rat(101707908) N-terminal EF-hand calcium binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1407861 Anti-NECAB1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA023252 Anti-NECAB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 Antibody Enhanced Validation mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
HPA023629 Anti-NECAB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 human, mouse
immunohistochemistry, western blot pricing
HPA025963 Anti-NECAB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab3 Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
HPA031262 Anti-NECAB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
SAB2107286 Anti-NECAB1 antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
AMAB90801 Monoclonal Anti-NECAB1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0576, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB90800 Monoclonal Anti-NECAB1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0575, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB90798 Monoclonal Anti-NECAB1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0580, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022351 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022351 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022351 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178617 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178617 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178617 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU051421 MISSION® esiRNA esiRNA targeting mouse Necab1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022351 Rosetta Predictions human pricing
NM_022302 Rosetta Predictions rat pricing
NM_178617 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142155 predicted 794
2 SASI_Hs01_00142156 predicted 479
3 SASI_Hs01_00142157 predicted 1164
4 SASI_Hs01_00142158 predicted 785
5 SASI_Hs01_00142160 predicted 637
6 SASI_Hs02_00355644 predicted 1048
7 SASI_Hs01_00142161 predicted 1329
8 SASI_Hs01_00142162 predicted 856
9 SASI_Hs01_00142163 predicted 292
10 SASI_Hs02_00355645 predicted 656
11 SASI_Hs01_00142159 predicted 1080
12 SASI_Hs01_00142164 predicted 1008
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022302 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090703 predicted 440
2 SASI_Rn01_00090704 predicted 431
3 SASI_Rn01_00090705 predicted 966
4 SASI_Rn01_00090706 predicted 586
5 SASI_Rn01_00090707 predicted 405
6 SASI_Rn01_00090708 predicted 589
7 SASI_Rn01_00090709 predicted 721
8 SASI_Rn01_00090710 predicted 737
9 SASI_Rn01_00090711 predicted 519
10 SASI_Rn01_00090712 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178617 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348970 predicted 494
2 SASI_Mm02_00348971 predicted 1143
3 SASI_Mm02_00348972 predicted 1081
4 SASI_Mm02_00348973 predicted 1329
5 SASI_Mm02_00348974 predicted 511
6 SASI_Mm02_00348975 predicted 704
7 SASI_Mm02_00348976 predicted 436
8 SASI_Mm02_00348977 predicted 1087
9 SASI_Mm02_00348978 predicted 1345
10 SASI_Mm02_00348979 predicted 851
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022351
NECAB1 MISSION shRNA Bacterial Glycerol Stock
N-terminal EF-hand calcium binding protein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022351.4-1645s21c1
Sequence:CCGGGTATACTGTAAAGGGTTAAATCTCGAGATTTAACCCTTTACAGTATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022351.4-707s21c1
Sequence:CCGGAGAAGTCCTGTCGATTCAATGCTCGAGCATTGAATCGACAGGACTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022351.4-799s21c1
Sequence:CCGGTCAGCGGTCCAGGCTTATTAGCTCGAGCTAATAAGCCTGGACCGCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022351.2-931s1c1
Sequence:CCGGCCAGATAAATAGACTCCAGAACTCGAGTTCTGGAGTCTATTTATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022351.2-1126s1c1
Sequence:CCGGCCAAAGTGGATGCTTGCGTATCTCGAGATACGCAAGCATCCACTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022351.2-657s1c1
Sequence:CCGGCCAATTTGGAACAATTCGTAACTCGAGTTACGAATTGTTCCAAATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022351.2-423s1c1
Sequence:CCGGCCTTTGAAGAATTCAAAGCATCTCGAGATGCTTTGAATTCTTCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022351.2-1225s1c1
Sequence:CCGGCCTTCAGACAAATTATAGCAACTCGAGTTGCTATAATTTGTCTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022351
NECAB1 MISSION shRNA shRNA Plasmid DNA
N-terminal EF-hand calcium binding protein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022351.4-1645s21c1
Sequence:CCGGGTATACTGTAAAGGGTTAAATCTCGAGATTTAACCCTTTACAGTATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022351.4-707s21c1
Sequence:CCGGAGAAGTCCTGTCGATTCAATGCTCGAGCATTGAATCGACAGGACTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022351.4-799s21c1
Sequence:CCGGTCAGCGGTCCAGGCTTATTAGCTCGAGCTAATAAGCCTGGACCGCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022351.2-931s1c1
Sequence:CCGGCCAGATAAATAGACTCCAGAACTCGAGTTCTGGAGTCTATTTATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022351.2-1126s1c1
Sequence:CCGGCCAAAGTGGATGCTTGCGTATCTCGAGATACGCAAGCATCCACTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022351.2-657s1c1
Sequence:CCGGCCAATTTGGAACAATTCGTAACTCGAGTTACGAATTGTTCCAAATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022351.2-423s1c1
Sequence:CCGGCCTTTGAAGAATTCAAAGCATCTCGAGATGCTTTGAATTCTTCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022351.2-1225s1c1
Sequence:CCGGCCTTCAGACAAATTATAGCAACTCGAGTTGCTATAATTTGTCTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022351
NECAB1 MISSION shRNA Lentiviral Transduction Particles
N-terminal EF-hand calcium binding protein 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022351.4-1645s21c1
Sequence:CCGGGTATACTGTAAAGGGTTAAATCTCGAGATTTAACCCTTTACAGTATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022351.4-707s21c1
Sequence:CCGGAGAAGTCCTGTCGATTCAATGCTCGAGCATTGAATCGACAGGACTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022351.4-799s21c1
Sequence:CCGGTCAGCGGTCCAGGCTTATTAGCTCGAGCTAATAAGCCTGGACCGCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022351.2-931s1c1
Sequence:CCGGCCAGATAAATAGACTCCAGAACTCGAGTTCTGGAGTCTATTTATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022351.2-1126s1c1
Sequence:CCGGCCAAAGTGGATGCTTGCGTATCTCGAGATACGCAAGCATCCACTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022351.2-657s1c1
Sequence:CCGGCCAATTTGGAACAATTCGTAACTCGAGTTACGAATTGTTCCAAATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022351.2-423s1c1
Sequence:CCGGCCTTTGAAGAATTCAAAGCATCTCGAGATGCTTTGAATTCTTCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022351.2-1225s1c1
Sequence:CCGGCCTTCAGACAAATTATAGCAACTCGAGTTGCTATAATTTGTCTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178617
NECAB1 MISSION shRNA Bacterial Glycerol Stock
N-terminal EF-hand calcium binding protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119997    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178617.3-1853s1c1
Sequence:CCGGCCTCCAACTATTTGCTTTATACTCGAGTATAAAGCAAATAGTTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178617.3-834s1c1
Sequence:CCGGCCAGTGGATGACCCAGATAAACTCGAGTTTATCTGGGTCATCCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178617.3-405s1c1
Sequence:CCGGCCACACCATTGACACACACAACTCGAGTTGTGTGTGTCAATGGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178617.3-568s1c1
Sequence:CCGGGCTTCCAATTTGGAACAATTTCTCGAGAAATTGTTCCAAATTGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178617.3-1077s1c1
Sequence:CCGGCTCAAACGAATCTCGCTACATCTCGAGATGTAGCGAGATTCGTTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178617
NECAB1 MISSION shRNA shRNA Plasmid DNA
N-terminal EF-hand calcium binding protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119997    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178617.3-1853s1c1
Sequence:CCGGCCTCCAACTATTTGCTTTATACTCGAGTATAAAGCAAATAGTTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178617.3-834s1c1
Sequence:CCGGCCAGTGGATGACCCAGATAAACTCGAGTTTATCTGGGTCATCCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178617.3-405s1c1
Sequence:CCGGCCACACCATTGACACACACAACTCGAGTTGTGTGTGTCAATGGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178617.3-568s1c1
Sequence:CCGGGCTTCCAATTTGGAACAATTTCTCGAGAAATTGTTCCAAATTGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178617.3-1077s1c1
Sequence:CCGGCTCAAACGAATCTCGCTACATCTCGAGATGTAGCGAGATTCGTTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178617
NECAB1 MISSION shRNA Lentiviral Transduction Particles
N-terminal EF-hand calcium binding protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119997    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178617.3-1853s1c1
Sequence:CCGGCCTCCAACTATTTGCTTTATACTCGAGTATAAAGCAAATAGTTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178617.3-834s1c1
Sequence:CCGGCCAGTGGATGACCCAGATAAACTCGAGTTTATCTGGGTCATCCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178617.3-405s1c1
Sequence:CCGGCCACACCATTGACACACACAACTCGAGTTGTGTGTGTCAATGGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178617.3-568s1c1
Sequence:CCGGGCTTCCAATTTGGAACAATTTCTCGAGAAATTGTTCCAAATTGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178617.3-1077s1c1
Sequence:CCGGCTCAAACGAATCTCGCTACATCTCGAGATGTAGCGAGATTCGTTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)