EMAIL THIS PAGE TO A FRIEND

NECAB2

N-terminal EF-hand calcium binding protein 2

49 Gene Product Result for
Synonyms: EFCBP2
UniProtKB ID: Q7Z6G3, A2RRG3, O75547, Q6ZSK0
Gene ID:
Mouse(117148) N-terminal EF-hand calcium binding protein 2
Rat(170928) N-terminal EF-hand calcium binding protein 2
naked mole-rat(101713554) N-terminal EF-hand calcium binding protein 2
domestic guinea pig(100730962) N-terminal EF-hand calcium binding protein 2
sheep(101122809) N-terminal EF-hand calcium binding protein 2
Zebrafish(565258) N-terminal EF-hand calcium binding protein 2
cow(515049) N-terminal EF-hand calcium binding protein 2
domestic cat(101087120) N-terminal EF-hand calcium binding protein 2
dog(489686) N-terminal EF-hand calcium binding protein 2
chicken(415705) N-terminal EF-hand calcium binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019065 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019065 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019065 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_054095 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054095 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054095 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019065 Rosetta Predictions human pricing
NM_133415 Rosetta Predictions rat pricing
NM_054095 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019065 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214478 predicted 1245
2 SASI_Hs01_00214479 predicted 460
3 SASI_Hs01_00214480 predicted 639
4 SASI_Hs01_00214482 predicted 906
5 SASI_Hs01_00214483 predicted 489
6 SASI_Hs01_00214484 predicted 1042
7 SASI_Hs01_00214485 predicted 1289
8 SASI_Hs01_00214486 predicted 956
9 SASI_Hs01_00214487 predicted 994
10 SASI_Hs02_00352654 predicted 1034
11 SASI_Hs01_00214481 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133415 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065122 predicted 748
2 SASI_Rn01_00065123 predicted 434
3 SASI_Rn01_00065124 predicted 1141
4 SASI_Rn01_00065125 predicted 1158
5 SASI_Rn01_00065126 predicted 303
6 SASI_Rn01_00065127 predicted 753
7 SASI_Rn01_00065128 predicted 204
8 SASI_Rn01_00065130 predicted 640
9 SASI_Rn01_00065131 predicted 1227
10 SASI_Rn02_00267671 predicted 1317
11 SASI_Rn01_00065129 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054095 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022327 predicted 1291
2 SASI_Mm01_00022328 predicted 1134
3 SASI_Mm01_00022329 predicted 1239
4 SASI_Mm01_00022330 predicted 696
5 SASI_Mm01_00022331 predicted 1126
6 SASI_Mm01_00022332 predicted 1603
7 SASI_Mm01_00022333 predicted 788
8 SASI_Mm02_00338038 predicted 931
9 SASI_Mm01_00022334 predicted 833
10 SASI_Mm01_00022335 predicted 837
11 SASI_Mm01_00022326 predicted 1239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019065
VALIDATED
NECAB2 MISSION shRNA Bacterial Glycerol Stock
N-terminal EF-hand calcium binding protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019065.2-527s21c1
Sequence:CCGGGAAGGAGACGGCCAATCAGATCTCGAGATCTGATTGGCCGTCTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019065.2-280s21c1
Sequence:CCGGTCTTTGCAGATGGCGTCCTTACTCGAGTAAGGACGCCATCTGCAAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019065.2-1299s21c1
Sequence:CCGGAGGTGTTTCCCTGTTGTTAAGCTCGAGCTTAACAACAGGGAAACACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019065.2-492s21c1
Sequence:CCGGAGCAACGTGGACCAGTTTGTGCTCGAGCACAAACTGGTCCACGTTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_019065.2-315s1c1
Sequence:CCGGGAGGATCTCTTTCACACGATTCTCGAGAATCGTGTGAAAGAGATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_019065.2-903s1c1
Sequence:CCGGCCCGAGCAACTGAGCGAGTTTCTCGAGAAACTCGCTCAGTTGCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_019065.2-1010s1c1
Sequence:CCGGCACCTTTGTCATCTATGAGTTCTCGAGAACTCATAGATGACAAAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_019065.2-371s1c1
Sequence:CCGGGCTGTGTGATTACTTTGTGGACTCGAGTCCACAAAGTAATCACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019065.2-609s1c1
Sequence:CCGGCTCCGACAGAACCACATCAAACTCGAGTTTGATGTGGTTCTGTCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019065
VALIDATED
NECAB2 MISSION shRNA shRNA Plasmid DNA
N-terminal EF-hand calcium binding protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019065.2-527s21c1
Sequence:CCGGGAAGGAGACGGCCAATCAGATCTCGAGATCTGATTGGCCGTCTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019065.2-280s21c1
Sequence:CCGGTCTTTGCAGATGGCGTCCTTACTCGAGTAAGGACGCCATCTGCAAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019065.2-1299s21c1
Sequence:CCGGAGGTGTTTCCCTGTTGTTAAGCTCGAGCTTAACAACAGGGAAACACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019065.2-492s21c1
Sequence:CCGGAGCAACGTGGACCAGTTTGTGCTCGAGCACAAACTGGTCCACGTTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_019065.2-315s1c1
Sequence:CCGGGAGGATCTCTTTCACACGATTCTCGAGAATCGTGTGAAAGAGATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_019065.2-903s1c1
Sequence:CCGGCCCGAGCAACTGAGCGAGTTTCTCGAGAAACTCGCTCAGTTGCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_019065.2-1010s1c1
Sequence:CCGGCACCTTTGTCATCTATGAGTTCTCGAGAACTCATAGATGACAAAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_019065.2-371s1c1
Sequence:CCGGGCTGTGTGATTACTTTGTGGACTCGAGTCCACAAAGTAATCACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019065.2-609s1c1
Sequence:CCGGCTCCGACAGAACCACATCAAACTCGAGTTTGATGTGGTTCTGTCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019065
VALIDATED
NECAB2 MISSION shRNA Lentiviral Transduction Particles
N-terminal EF-hand calcium binding protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019065.2-527s21c1
Sequence:CCGGGAAGGAGACGGCCAATCAGATCTCGAGATCTGATTGGCCGTCTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019065.2-280s21c1
Sequence:CCGGTCTTTGCAGATGGCGTCCTTACTCGAGTAAGGACGCCATCTGCAAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019065.2-1299s21c1
Sequence:CCGGAGGTGTTTCCCTGTTGTTAAGCTCGAGCTTAACAACAGGGAAACACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019065.2-492s21c1
Sequence:CCGGAGCAACGTGGACCAGTTTGTGCTCGAGCACAAACTGGTCCACGTTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_019065.2-315s1c1
Sequence:CCGGGAGGATCTCTTTCACACGATTCTCGAGAATCGTGTGAAAGAGATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_019065.2-903s1c1
Sequence:CCGGCCCGAGCAACTGAGCGAGTTTCTCGAGAAACTCGCTCAGTTGCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_019065.2-1010s1c1
Sequence:CCGGCACCTTTGTCATCTATGAGTTCTCGAGAACTCATAGATGACAAAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_019065.2-371s1c1
Sequence:CCGGGCTGTGTGATTACTTTGTGGACTCGAGTCCACAAAGTAATCACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019065.2-609s1c1
Sequence:CCGGCTCCGACAGAACCACATCAAACTCGAGTTTGATGTGGTTCTGTCGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054095
NECAB2 MISSION shRNA Bacterial Glycerol Stock
N-terminal EF-hand calcium binding protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054095.1-1574s1c1
Sequence:CCGGCTTTGGTAAACTGCTGTCTTTCTCGAGAAAGACAGCAGTTTACCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054095.1-641s1c1
Sequence:CCGGGCCTCTTCCATACCATCGATTCTCGAGAATCGATGGTATGGAAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054095.1-1323s1c1
Sequence:CCGGAGATGGCCTAACCTTCGTCATCTCGAGATGACGAAGGTTAGGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054095.1-1285s1c1
Sequence:CCGGGAAAGGAACTGCTTCCATGTTCTCGAGAACATGGAAGCAGTTCCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054095.1-1405s1c1
Sequence:CCGGGCCTTCCGACACGTCAAGGTTCTCGAGAACCTTGACGTGTCGGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054095
NECAB2 MISSION shRNA shRNA Plasmid DNA
N-terminal EF-hand calcium binding protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054095.1-1574s1c1
Sequence:CCGGCTTTGGTAAACTGCTGTCTTTCTCGAGAAAGACAGCAGTTTACCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054095.1-641s1c1
Sequence:CCGGGCCTCTTCCATACCATCGATTCTCGAGAATCGATGGTATGGAAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054095.1-1323s1c1
Sequence:CCGGAGATGGCCTAACCTTCGTCATCTCGAGATGACGAAGGTTAGGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054095.1-1285s1c1
Sequence:CCGGGAAAGGAACTGCTTCCATGTTCTCGAGAACATGGAAGCAGTTCCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054095.1-1405s1c1
Sequence:CCGGGCCTTCCGACACGTCAAGGTTCTCGAGAACCTTGACGTGTCGGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054095
NECAB2 MISSION shRNA Lentiviral Transduction Particles
N-terminal EF-hand calcium binding protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054095.1-1574s1c1
Sequence:CCGGCTTTGGTAAACTGCTGTCTTTCTCGAGAAAGACAGCAGTTTACCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054095.1-641s1c1
Sequence:CCGGGCCTCTTCCATACCATCGATTCTCGAGAATCGATGGTATGGAAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054095.1-1323s1c1
Sequence:CCGGAGATGGCCTAACCTTCGTCATCTCGAGATGACGAAGGTTAGGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054095.1-1285s1c1
Sequence:CCGGGAAAGGAACTGCTTCCATGTTCTCGAGAACATGGAAGCAGTTCCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054095.1-1405s1c1
Sequence:CCGGGCCTTCCGACACGTCAAGGTTCTCGAGAACCTTGACGTGTCGGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)