EMAIL THIS PAGE TO A FRIEND

NECAB3

N-terminal EF-hand calcium binding protein 3

87 Gene Product Result for
Synonyms: APBA2BP EFCBP3 NIP1 STIP3 SYTIP2 XB51 dJ63M2.4 dJ63M2.5
Gene ID:
Human(63941) Summary: The protein encoded by this gene interacts with the amino-terminal domain of the neuron-specific X11-like protein (X11L), inhibits the association of X11L with amyloid precursor protein through a non-competitive mechanism, and abolishes the suppression of beta-amyloid production by X11L. This protein, together with X11L, may play an important role in the regulatory system of amyloid precursor protein metabolism and beta-amyloid generation. The protein is phosphorylated by NIMA-related expressed kinase 2, and localizes to the Golgi apparatus. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(56846) N-terminal EF-hand calcium binding protein 3
Rat(311562) N-terminal EF-hand calcium binding protein 3
chicken(419154) N-terminal EF-hand calcium binding protein 3
dog(608658) N-terminal EF-hand calcium binding protein 3
domestic cat(101098703) N-terminal EF-hand calcium binding protein 3
cow(514695) N-terminal EF-hand calcium binding protein 3
sheep(101117268) N-terminal EF-hand calcium binding protein 3
domestic guinea pig(100730071) N-terminal EF-hand calcium binding protein 3
naked mole-rat(101719008) N-terminal EF-hand calcium binding protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031231 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031231 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031231 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021546 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021546 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021546 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031231 Rosetta Predictions human pricing
NM_031232 Rosetta Predictions human pricing
NM_001098724 Rosetta Predictions rat pricing
NM_021546 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031231 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145553 predicted 506
2 SASI_Hs01_00145554 predicted 1168
3 SASI_Hs01_00145555 predicted 498
4 SASI_Hs01_00145556 predicted 1025
5 SASI_Hs01_00145557 predicted 489
6 SASI_Hs01_00145558 predicted 1051
7 SASI_Hs01_00145559 predicted 477
8 SASI_Hs01_00145560 predicted 433
9 SASI_Hs01_00145561 predicted 402
10 SASI_Hs01_00145562 predicted 1096
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184312 predicted 503
2 SASI_Hs01_00184313 predicted 1266
3 SASI_Hs01_00184314 predicted 499
4 SASI_Hs01_00184315 predicted 1130
5 SASI_Hs01_00184316 predicted 491
6 SASI_Hs01_00184317 predicted 1147
7 SASI_Hs01_00184318 predicted 474
8 SASI_Hs01_00184319 predicted 427
9 SASI_Hs01_00184320 predicted 396
10 SASI_Hs01_00184321 predicted 1194
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098724 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209141 predicted 252
2 SASI_Rn02_00209142 predicted 881
3 SASI_Rn02_00209143 predicted 884
4 SASI_Rn02_00209144 predicted 262
5 SASI_Rn02_00209145 predicted 229
6 SASI_Rn02_00209146 predicted 350
7 SASI_Rn02_00209147 predicted 1061
8 SASI_Rn02_00209148 predicted 344
9 SASI_Rn02_00209149 predicted 889
10 SASI_Rn02_00209150 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021546 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326294 predicted 745
2 SASI_Mm01_00187415 predicted 905
3 SASI_Mm01_00187416 predicted 827
4 SASI_Mm02_00326295 predicted 352
5 SASI_Mm02_00326296 predicted 819
6 SASI_Mm01_00187414 predicted 393
7 SASI_Mm02_00326297 predicted 408
8 SASI_Mm02_00326298 predicted 355
9 SASI_Mm02_00326299 predicted 264
10 SASI_Mm02_00326300 predicted 407
11 SASI_Mm01_00187412 predicted 739
12 SASI_Mm01_00187413 predicted 213
13 SASI_Mm01_00187417 predicted 726
14 SASI_Mm01_00187418 predicted 684
15 SASI_Mm01_00187419 predicted 627
16 SASI_Mm01_00187420 predicted 1336
17 SASI_Mm01_00187421 predicted 949
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031231
VALIDATED
NECAB3 MISSION shRNA Bacterial Glycerol Stock
N-terminal EF-hand calcium binding protein 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031231.3-1404s21c1
Sequence:CCGGTTCAGCCTCCAAGCTACTTTGCTCGAGCAAAGTAGCTTGGAGGCTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031231.3-333s21c1
Sequence:CCGGAGGAACTGTTCAGCGGCATTGCTCGAGCAATGCCGCTGAACAGTTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031231.3-1173s21c1
Sequence:CCGGGGTGGATAATGAATAACAACTCTCGAGAGTTGTTATTCATTATCCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031231.2-1341s1c1
Sequence:CCGGGCTGCTTGCTTTCTATTTATTCTCGAGAATAAATAGAAAGCAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031231.2-1032s1c1
Sequence:CCGGCTGTATGAGTTCTGGCAGGATCTCGAGATCCTGCCAGAACTCATACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031231.2-240s1c1
Sequence:CCGGCGCAGAGCAGACAAGAATGATCTCGAGATCATTCTTGTCTGCTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031231.2-504s1c1
Sequence:CCGGGCCTCCAAAGTGGACCAGTTTCTCGAGAAACTGGTCCACTTTGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031231.2-364s1c1
Sequence:CCGGCCGACAATTTAGAAACAGAAACTCGAGTTTCTGTTTCTAAATTGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031231
VALIDATED
NECAB3 MISSION shRNA shRNA Plasmid DNA
N-terminal EF-hand calcium binding protein 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031231.3-1404s21c1
Sequence:CCGGTTCAGCCTCCAAGCTACTTTGCTCGAGCAAAGTAGCTTGGAGGCTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031231.3-333s21c1
Sequence:CCGGAGGAACTGTTCAGCGGCATTGCTCGAGCAATGCCGCTGAACAGTTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031231.3-1173s21c1
Sequence:CCGGGGTGGATAATGAATAACAACTCTCGAGAGTTGTTATTCATTATCCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031231.2-1341s1c1
Sequence:CCGGGCTGCTTGCTTTCTATTTATTCTCGAGAATAAATAGAAAGCAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031231.2-1032s1c1
Sequence:CCGGCTGTATGAGTTCTGGCAGGATCTCGAGATCCTGCCAGAACTCATACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031231.2-240s1c1
Sequence:CCGGCGCAGAGCAGACAAGAATGATCTCGAGATCATTCTTGTCTGCTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031231.2-504s1c1
Sequence:CCGGGCCTCCAAAGTGGACCAGTTTCTCGAGAAACTGGTCCACTTTGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031231.2-364s1c1
Sequence:CCGGCCGACAATTTAGAAACAGAAACTCGAGTTTCTGTTTCTAAATTGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031231
VALIDATED
NECAB3 MISSION shRNA Lentiviral Transduction Particles
N-terminal EF-hand calcium binding protein 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031231.3-1404s21c1
Sequence:CCGGTTCAGCCTCCAAGCTACTTTGCTCGAGCAAAGTAGCTTGGAGGCTGAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031231.3-333s21c1
Sequence:CCGGAGGAACTGTTCAGCGGCATTGCTCGAGCAATGCCGCTGAACAGTTCCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031231.3-1173s21c1
Sequence:CCGGGGTGGATAATGAATAACAACTCTCGAGAGTTGTTATTCATTATCCACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031231.2-1341s1c1
Sequence:CCGGGCTGCTTGCTTTCTATTTATTCTCGAGAATAAATAGAAAGCAAGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031231.2-1032s1c1
Sequence:CCGGCTGTATGAGTTCTGGCAGGATCTCGAGATCCTGCCAGAACTCATACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031231.2-240s1c1
Sequence:CCGGCGCAGAGCAGACAAGAATGATCTCGAGATCATTCTTGTCTGCTCTGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031231.2-504s1c1
Sequence:CCGGGCCTCCAAAGTGGACCAGTTTCTCGAGAAACTGGTCCACTTTGGAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031231.2-364s1c1
Sequence:CCGGCCGACAATTTAGAAACAGAAACTCGAGTTTCTGTTTCTAAATTGTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021546
NECAB3 MISSION shRNA Bacterial Glycerol Stock
N-terminal EF-hand calcium binding protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120002    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021546.1-1446s1c1
Sequence:CCGGGCCTATCATTTGCATGTCTTACTCGAGTAAGACATGCAAATGATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021546.1-645s1c1
Sequence:CCGGTCGTGCTTTGTGCTGCTACATCTCGAGATGTAGCAGCACAAAGCACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021546.1-872s1c1
Sequence:CCGGCCTGGTGGATTATGAATAATACTCGAGTATTATTCATAATCCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021546.1-220s1c1
Sequence:CCGGGACCAGTTTGTCACACGATTTCTCGAGAAATCGTGTGACAAACTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021546.1-440s1c1
Sequence:CCGGCCTCTGATACAGGGCGGAGTTCTCGAGAACTCCGCCCTGTATCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021546
NECAB3 MISSION shRNA shRNA Plasmid DNA
N-terminal EF-hand calcium binding protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120002    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021546.1-1446s1c1
Sequence:CCGGGCCTATCATTTGCATGTCTTACTCGAGTAAGACATGCAAATGATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021546.1-645s1c1
Sequence:CCGGTCGTGCTTTGTGCTGCTACATCTCGAGATGTAGCAGCACAAAGCACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021546.1-872s1c1
Sequence:CCGGCCTGGTGGATTATGAATAATACTCGAGTATTATTCATAATCCACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021546.1-220s1c1
Sequence:CCGGGACCAGTTTGTCACACGATTTCTCGAGAAATCGTGTGACAAACTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021546.1-440s1c1
Sequence:CCGGCCTCTGATACAGGGCGGAGTTCTCGAGAACTCCGCCCTGTATCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021546
NECAB3 MISSION shRNA Lentiviral Transduction Particles
N-terminal EF-hand calcium binding protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120002    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021546.1-1446s1c1
Sequence:CCGGGCCTATCATTTGCATGTCTTACTCGAGTAAGACATGCAAATGATAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021546.1-645s1c1
Sequence:CCGGTCGTGCTTTGTGCTGCTACATCTCGAGATGTAGCAGCACAAAGCACGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021546.1-872s1c1
Sequence:CCGGCCTGGTGGATTATGAATAATACTCGAGTATTATTCATAATCCACCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021546.1-220s1c1
Sequence:CCGGGACCAGTTTGTCACACGATTTCTCGAGAAATCGTGTGACAAACTGGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021546.1-440s1c1
Sequence:CCGGCCTCTGATACAGGGCGGAGTTCTCGAGAACTCCGCCCTGTATCAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)