EMAIL THIS PAGE TO A FRIEND

NECAP1

NECAP endocytosis associated 1

193 Gene Product Result for
Gene ID:
Mouse(67602) NECAP endocytosis associated 1
Rat(312694) NECAP endocytosis associated 1
naked mole-rat(101711171) NECAP endocytosis associated 1
domestic guinea pig(100725574) NECAP endocytosis associated 1
sheep(101102302) NECAP endocytosis associated 1
Zebrafish(393695) NECAP endocytosis associated 1
chicken(770083) NECAP endocytosis associated 1
cow(504449) NECAP endocytosis associated 1
domestic cat(101096241) NECAP endocytosis associated 1
dog(486705) NECAP endocytosis associated 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026267 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026267 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026267 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015509 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015509 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015509 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015509 Rosetta Predictions human pricing
NM_001029919 Rosetta Predictions rat pricing
NM_026267 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015509 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159753 predicted 252
2 SASI_Hs02_00347993 predicted 525
3 SASI_Hs01_00159754 predicted 934
4 SASI_Hs01_00159755 predicted 471
5 SASI_Hs01_00159756 predicted 361
6 SASI_Hs01_00159759 predicted 1017
7 SASI_Hs01_00159760 predicted 1105
8 SASI_Hs01_00159761 predicted 1004
9 SASI_Hs01_00159762 predicted 323
10 SASI_Hs02_00347994 predicted 453
11 SASI_Hs01_00159757 predicted 984
12 SASI_Hs01_00159758 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029919 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033374 predicted 756
2 SASI_Rn01_00033375 predicted 1291
3 SASI_Rn01_00033376 predicted 328
4 SASI_Rn01_00033377 predicted 685
5 SASI_Rn01_00033378 predicted 484
6 SASI_Rn01_00033379 predicted 324
7 SASI_Rn01_00033380 predicted 234
8 SASI_Rn01_00033381 predicted 469
9 SASI_Rn01_00033382 predicted 1225
10 SASI_Rn01_00033383 predicted 455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026267 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181615 predicted 1093
2 SASI_Mm01_00181616 predicted 1072
3 SASI_Mm01_00181617 predicted 280
4 SASI_Mm01_00181618 predicted 928
5 SASI_Mm01_00181619 predicted 676
6 SASI_Mm01_00181620 predicted 1088
7 SASI_Mm01_00181621 predicted 671
8 SASI_Mm01_00181622 predicted 965
9 SASI_Mm01_00181624 predicted 935
10 SASI_Mm02_00329956 predicted 443
11 SASI_Mm01_00181623 predicted 1136
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026267
VALIDATED
NECAP1 MISSION shRNA Bacterial Glycerol Stock
NECAP endocytosis associated 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026267.2-446s1c1
Sequence:CCGGATCGTCCCAAGTTGGATTTAGCTCGAGCTAAATCCAACTTGGGACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026267.1-1565s1c1
Sequence:CCGGGCTCCATGTAATTGCTGCATTCTCGAGAATGCAGCAATTACATGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175176    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026267.1-2182s1c1
Sequence:CCGGCGATACAAACACTAAGAAGAACTCGAGTTCTTCTTAGTGTTTGTATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026267.1-407s1c1
Sequence:CCGGCAGGAAACTGAGATTTCCAAACTCGAGTTTGGAAATCTCAGTTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026267.1-382s1c1
Sequence:CCGGGCAAGATCACTTCAAGTGGGTCTCGAGACCCACTTGAAGTGATCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026267.1-487s1c1
Sequence:CCGGCATCAAATTGAGTATTGGGAACTCGAGTTCCCAATACTCAATTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026267.1-1960s1c1
Sequence:CCGGCCTTTGTTTGTTGGGCAGTTTCTCGAGAAACTGCCCAACAAACAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026267.1-1470s1c1
Sequence:CCGGGCAGCATCTTTGACCAGTGAACTCGAGTTCACTGGTCAAAGATGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026267.1-232s1c1
Sequence:CCGGCGTAGAACAGTATCCTGGGATCTCGAGATCCCAGGATACTGTTCTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026267.1-365s1c1
Sequence:CCGGGACTTTAATGTTTCCCTGCAACTCGAGTTGCAGGGAAACATTAAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026267
VALIDATED
NECAP1 MISSION shRNA shRNA Plasmid DNA
NECAP endocytosis associated 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026267.2-446s1c1
Sequence:CCGGATCGTCCCAAGTTGGATTTAGCTCGAGCTAAATCCAACTTGGGACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026267.1-1565s1c1
Sequence:CCGGGCTCCATGTAATTGCTGCATTCTCGAGAATGCAGCAATTACATGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175176    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026267.1-2182s1c1
Sequence:CCGGCGATACAAACACTAAGAAGAACTCGAGTTCTTCTTAGTGTTTGTATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026267.1-407s1c1
Sequence:CCGGCAGGAAACTGAGATTTCCAAACTCGAGTTTGGAAATCTCAGTTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026267.1-382s1c1
Sequence:CCGGGCAAGATCACTTCAAGTGGGTCTCGAGACCCACTTGAAGTGATCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026267.1-487s1c1
Sequence:CCGGCATCAAATTGAGTATTGGGAACTCGAGTTCCCAATACTCAATTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026267.1-1960s1c1
Sequence:CCGGCCTTTGTTTGTTGGGCAGTTTCTCGAGAAACTGCCCAACAAACAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026267.1-1470s1c1
Sequence:CCGGGCAGCATCTTTGACCAGTGAACTCGAGTTCACTGGTCAAAGATGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026267.1-232s1c1
Sequence:CCGGCGTAGAACAGTATCCTGGGATCTCGAGATCCCAGGATACTGTTCTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026267.1-365s1c1
Sequence:CCGGGACTTTAATGTTTCCCTGCAACTCGAGTTGCAGGGAAACATTAAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026267
VALIDATED
NECAP1 MISSION shRNA Lentiviral Transduction Particles
NECAP endocytosis associated 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026267.2-446s1c1
Sequence:CCGGATCGTCCCAAGTTGGATTTAGCTCGAGCTAAATCCAACTTGGGACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026267.1-1565s1c1
Sequence:CCGGGCTCCATGTAATTGCTGCATTCTCGAGAATGCAGCAATTACATGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175176    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026267.1-2182s1c1
Sequence:CCGGCGATACAAACACTAAGAAGAACTCGAGTTCTTCTTAGTGTTTGTATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026267.1-407s1c1
Sequence:CCGGCAGGAAACTGAGATTTCCAAACTCGAGTTTGGAAATCTCAGTTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026267.1-382s1c1
Sequence:CCGGGCAAGATCACTTCAAGTGGGTCTCGAGACCCACTTGAAGTGATCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026267.1-487s1c1
Sequence:CCGGCATCAAATTGAGTATTGGGAACTCGAGTTCCCAATACTCAATTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026267.1-1960s1c1
Sequence:CCGGCCTTTGTTTGTTGGGCAGTTTCTCGAGAAACTGCCCAACAAACAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026267.1-1470s1c1
Sequence:CCGGGCAGCATCTTTGACCAGTGAACTCGAGTTCACTGGTCAAAGATGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026267.1-232s1c1
Sequence:CCGGCGTAGAACAGTATCCTGGGATCTCGAGATCCCAGGATACTGTTCTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026267.1-365s1c1
Sequence:CCGGGACTTTAATGTTTCCCTGCAACTCGAGTTGCAGGGAAACATTAAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015509
NECAP1 MISSION shRNA Bacterial Glycerol Stock
NECAP endocytosis associated 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015509.2-532s1c1
Sequence:CCGGCAAGTTGTGTATCGGGAACATCTCGAGATGTTCCCGATACACAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015509.2-273s1c1
Sequence:CCGGCAGTAGAACAATATCCTGGTACTCGAGTACCAGGATATTGTTCTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015509.2-403s1c1
Sequence:CCGGCTTCGACTTTAATGTCTCCTTCTCGAGAAGGAGACATTAAAGTCGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164649    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015509.2-1694s1c1
Sequence:CCGGGCTGCATTTGAAGCATGGCATCTCGAGATGCCATGCTTCAAATGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015509.2-695s1c1
Sequence:CCGGCCCATTCCGAAATCTAACCATCTCGAGATGGTTAGATTTCGGAATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015509.2-452s1c1
Sequence:CCGGGAATCTGAGATTTCCAAGGAACTCGAGTTCCTTGGAAATCTCAGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160346    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015509.2-1850s1c1
Sequence:CCGGCCCTTTCCATAAACATTTCTTCTCGAGAAGAAATGTTTATGGAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015509.2-720s1c1
Sequence:CCGGGCAGTGATGCAGATATCCTTTCTCGAGAAAGGATATCTGCATCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015509.2-529s1c1
Sequence:CCGGCATCAAGTTGTGTATCGGGAACTCGAGTTCCCGATACACAACTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015509.2-406s1c1
Sequence:CCGGCGACTTTAATGTCTCCTTGCACTCGAGTGCAAGGAGACATTAAAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162887    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015509.2-2041s1c1
Sequence:CCGGGCCCTGCCATTCCTATTACAACTCGAGTTGTAATAGGAATGGCAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015509.2-2304s1c1
Sequence:CCGGGCTCTATTCTTGCAGAGCCATCTCGAGATGGCTCTGCAAGAATAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015509.2-359s1c1
Sequence:CCGGCGCAGTGCTTTCATTGGCATTCTCGAGAATGCCAATGAAAGCACTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015509
NECAP1 MISSION shRNA shRNA Plasmid DNA
NECAP endocytosis associated 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015509.2-532s1c1
Sequence:CCGGCAAGTTGTGTATCGGGAACATCTCGAGATGTTCCCGATACACAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015509.2-273s1c1
Sequence:CCGGCAGTAGAACAATATCCTGGTACTCGAGTACCAGGATATTGTTCTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015509.2-403s1c1
Sequence:CCGGCTTCGACTTTAATGTCTCCTTCTCGAGAAGGAGACATTAAAGTCGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164649    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015509.2-1694s1c1
Sequence:CCGGGCTGCATTTGAAGCATGGCATCTCGAGATGCCATGCTTCAAATGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015509.2-695s1c1
Sequence:CCGGCCCATTCCGAAATCTAACCATCTCGAGATGGTTAGATTTCGGAATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015509.2-452s1c1
Sequence:CCGGGAATCTGAGATTTCCAAGGAACTCGAGTTCCTTGGAAATCTCAGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160346    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015509.2-1850s1c1
Sequence:CCGGCCCTTTCCATAAACATTTCTTCTCGAGAAGAAATGTTTATGGAAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015509.2-720s1c1
Sequence:CCGGGCAGTGATGCAGATATCCTTTCTCGAGAAAGGATATCTGCATCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015509.2-529s1c1
Sequence:CCGGCATCAAGTTGTGTATCGGGAACTCGAGTTCCCGATACACAACTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015509.2-406s1c1
Sequence:CCGGCGACTTTAATGTCTCCTTGCACTCGAGTGCAAGGAGACATTAAAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162887    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015509.2-2041s1c1
Sequence:CCGGGCCCTGCCATTCCTATTACAACTCGAGTTGTAATAGGAATGGCAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015509.2-2304s1c1
Sequence:CCGGGCTCTATTCTTGCAGAGCCATCTCGAGATGGCTCTGCAAGAATAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015509.2-359s1c1
Sequence:CCGGCGCAGTGCTTTCATTGGCATTCTCGAGAATGCCAATGAAAGCACTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015509
NECAP1 MISSION shRNA Lentiviral Transduction Particles
NECAP endocytosis associated 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015509.2-532s1c1
Sequence:CCGGCAAGTTGTGTATCGGGAACATCTCGAGATGTTCCCGATACACAACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015509.2-273s1c1
Sequence:CCGGCAGTAGAACAATATCCTGGTACTCGAGTACCAGGATATTGTTCTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015509.2-403s1c1
Sequence:CCGGCTTCGACTTTAATGTCTCCTTCTCGAGAAGGAGACATTAAAGTCGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164649    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015509.2-1694s1c1
Sequence:CCGGGCTGCATTTGAAGCATGGCATCTCGAGATGCCATGCTTCAAATGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015509.2-695s1c1
Sequence:CCGGCCCATTCCGAAATCTAACCATCTCGAGATGGTTAGATTTCGGAATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015509.2-452s1c1
Sequence:CCGGGAATCTGAGATTTCCAAGGAACTCGAGTTCCTTGGAAATCTCAGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160346    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015509.2-1850s1c1
Sequence:CCGGCCCTTTCCATAAACATTTCTTCTCGAGAAGAAATGTTTATGGAAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015509.2-720s1c1
Sequence:CCGGGCAGTGATGCAGATATCCTTTCTCGAGAAAGGATATCTGCATCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015509.2-529s1c1
Sequence:CCGGCATCAAGTTGTGTATCGGGAACTCGAGTTCCCGATACACAACTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015509.2-406s1c1
Sequence:CCGGCGACTTTAATGTCTCCTTGCACTCGAGTGCAAGGAGACATTAAAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162887    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015509.2-2041s1c1
Sequence:CCGGGCCCTGCCATTCCTATTACAACTCGAGTTGTAATAGGAATGGCAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015509.2-2304s1c1
Sequence:CCGGGCTCTATTCTTGCAGAGCCATCTCGAGATGGCTCTGCAAGAATAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015509.2-359s1c1
Sequence:CCGGCGCAGTGCTTTCATTGGCATTCTCGAGAATGCCAATGAAAGCACTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)