EMAIL THIS PAGE TO A FRIEND

NECAP2

NECAP endocytosis associated 2

73 Gene Product Result for
Gene ID:
Human(55707) Summary: This gene likely encodes a member of the adaptin-ear-binding coat-associated protein family. Studies of a similar protein in rat suggest a role in clathrin-mediated endocytosis. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Mouse(66147) NECAP endocytosis associated 2
Rat(298598) NECAP endocytosis associated 2
Zebrafish(553536) NECAP endocytosis associated 2
chicken(419464) NECAP endocytosis associated 2
cow(509439) NECAP endocytosis associated 2
domestic cat(101084375) NECAP endocytosis associated 2
dog(478218) NECAP endocytosis associated 2
sheep(101110655) NECAP endocytosis associated 2
domestic guinea pig(100729918) NECAP endocytosis associated 2
naked mole-rat(101717544) NECAP endocytosis associated 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018090 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018090 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018090 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025383 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025383 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025383 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063831 MISSION® esiRNA esiRNA human NECAP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018090 Rosetta Predictions human pricing
NM_199096 Rosetta Predictions rat pricing
NM_025383 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018090 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050134 predicted 960
2 SASI_Hs02_00351268 predicted 758
3 SASI_Hs01_00050135 predicted 329
4 SASI_Hs01_00050136 predicted 1084
5 SASI_Hs01_00050137 predicted 802
6 SASI_Hs01_00050138 predicted 1108
7 SASI_Hs02_00351269 predicted 678
8 SASI_Hs01_00050139 predicted 381
9 SASI_Hs01_00050140 predicted 405
10 SASI_Hs01_00050142 predicted 965
11 SASI_Hs01_00050141 predicted 1200
12 SASI_Hs01_00050143 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119362 predicted 375
2 SASI_Rn01_00119363 predicted 1077
3 SASI_Rn01_00119364 predicted 486
4 SASI_Rn01_00119367 predicted 279
5 SASI_Rn01_00119368 predicted 381
6 SASI_Rn01_00119369 predicted 1070
7 SASI_Rn01_00119370 predicted 1243
8 SASI_Rn02_00270110 predicted 1108
9 SASI_Rn02_00270111 predicted 947
10 SASI_Rn02_00270112 predicted 1072
11 SASI_Rn01_00119365 predicted 257
12 SASI_Rn01_00119366 predicted 987
13 SASI_Rn01_00119371 predicted 1110
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025383 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149091 predicted 299
2 SASI_Mm01_00149092 predicted 443
3 SASI_Mm01_00149093 predicted 1106
4 SASI_Mm01_00149094 predicted 504
5 SASI_Mm01_00149095 predicted 984
6 SASI_Mm02_00328115 predicted 1039
7 SASI_Mm01_00149097 predicted 1258
8 SASI_Mm01_00149098 predicted 430
9 SASI_Mm01_00149099 predicted 1303
10 SASI_Mm01_00149100 predicted 1139
11 SASI_Mm01_00149096 predicted 284
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018090
VALIDATED
NECAP2 MISSION shRNA Bacterial Glycerol Stock
NECAP endocytosis associated 2
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018090.3-489s1c1
Sequence:CCGGCCAGACCATCAAGCTCAACATCTCGAGATGTTGAGCTTGATGGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165698    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_018090.3-961s1c1
Sequence:CCGGCGGGCATGTTTGGCAGTAAATCTCGAGATTTACTGCCAAACATGCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_018090.3-504s1c1
Sequence:CCGGCAACATCGCAAACATGAAGAACTCGAGTTCTTCATGTTTGCGATGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_018090.3-364s1c1
Sequence:CCGGGATGCCTTTGACTTCAATGTTCTCGAGAACATTGAAGTCAAAGGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018090.3-394s1c1
Sequence:CCGGGACCATTTCAAGTGGGTGAAACTCGAGTTTCACCCACTTGAAATGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018090.3-501s1c1
Sequence:CCGGGCTCAACATCGCAAACATGAACTCGAGTTCATGTTTGCGATGTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_018090.3-498s1c1
Sequence:CCGGCAAGCTCAACATCGCAAACATCTCGAGATGTTTGCGATGTTGAGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_018090.3-300s1c1
Sequence:CCGGGATCCGCATCGAAGATGGAAACTCGAGTTTCCATCTTCGATGCGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018090.3-378s1c1
Sequence:CCGGCAATGTTGCATTGCAGGACCACTCGAGTGGTCCTGCAATGCAACATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_018090.3-961s21c1
Sequence:CCGGCGGGCATGTTTGGCAGTAAATCTCGAGATTTACTGCCAAACATGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_018090.3-326s21c1
Sequence:CCGGGACGGGCGTTTATTGGAATTGCTCGAGCAATTCCAATAAACGCCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018090.3-755s21c1
Sequence:CCGGCCAAATCTACAGGATCAACTTCTCGAGAAGTTGATCCTGTAGATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_018090.3-277s21c1
Sequence:CCGGACGGATTCCAGCAGGTACTTCCTCGAGGAAGTACCTGCTGGAATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_018090.3-498s21c1
Sequence:CCGGCAAGCTCAACATCGCAAACATCTCGAGATGTTTGCGATGTTGAGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018090
VALIDATED
NECAP2 MISSION shRNA shRNA Plasmid DNA
NECAP endocytosis associated 2
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018090.3-489s1c1
Sequence:CCGGCCAGACCATCAAGCTCAACATCTCGAGATGTTGAGCTTGATGGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165698    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_018090.3-961s1c1
Sequence:CCGGCGGGCATGTTTGGCAGTAAATCTCGAGATTTACTGCCAAACATGCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_018090.3-504s1c1
Sequence:CCGGCAACATCGCAAACATGAAGAACTCGAGTTCTTCATGTTTGCGATGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_018090.3-364s1c1
Sequence:CCGGGATGCCTTTGACTTCAATGTTCTCGAGAACATTGAAGTCAAAGGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018090.3-394s1c1
Sequence:CCGGGACCATTTCAAGTGGGTGAAACTCGAGTTTCACCCACTTGAAATGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018090.3-501s1c1
Sequence:CCGGGCTCAACATCGCAAACATGAACTCGAGTTCATGTTTGCGATGTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_018090.3-498s1c1
Sequence:CCGGCAAGCTCAACATCGCAAACATCTCGAGATGTTTGCGATGTTGAGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_018090.3-300s1c1
Sequence:CCGGGATCCGCATCGAAGATGGAAACTCGAGTTTCCATCTTCGATGCGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018090.3-378s1c1
Sequence:CCGGCAATGTTGCATTGCAGGACCACTCGAGTGGTCCTGCAATGCAACATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_018090.3-961s21c1
Sequence:CCGGCGGGCATGTTTGGCAGTAAATCTCGAGATTTACTGCCAAACATGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_018090.3-326s21c1
Sequence:CCGGGACGGGCGTTTATTGGAATTGCTCGAGCAATTCCAATAAACGCCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018090.3-755s21c1
Sequence:CCGGCCAAATCTACAGGATCAACTTCTCGAGAAGTTGATCCTGTAGATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_018090.3-277s21c1
Sequence:CCGGACGGATTCCAGCAGGTACTTCCTCGAGGAAGTACCTGCTGGAATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_018090.3-498s21c1
Sequence:CCGGCAAGCTCAACATCGCAAACATCTCGAGATGTTTGCGATGTTGAGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018090
VALIDATED
NECAP2 MISSION shRNA Lentiviral Transduction Particles
NECAP endocytosis associated 2
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018090.3-489s1c1
Sequence:CCGGCCAGACCATCAAGCTCAACATCTCGAGATGTTGAGCTTGATGGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165698    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_018090.3-961s1c1
Sequence:CCGGCGGGCATGTTTGGCAGTAAATCTCGAGATTTACTGCCAAACATGCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_018090.3-504s1c1
Sequence:CCGGCAACATCGCAAACATGAAGAACTCGAGTTCTTCATGTTTGCGATGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_018090.3-364s1c1
Sequence:CCGGGATGCCTTTGACTTCAATGTTCTCGAGAACATTGAAGTCAAAGGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018090.3-394s1c1
Sequence:CCGGGACCATTTCAAGTGGGTGAAACTCGAGTTTCACCCACTTGAAATGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018090.3-501s1c1
Sequence:CCGGGCTCAACATCGCAAACATGAACTCGAGTTCATGTTTGCGATGTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_018090.3-498s1c1
Sequence:CCGGCAAGCTCAACATCGCAAACATCTCGAGATGTTTGCGATGTTGAGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_018090.3-300s1c1
Sequence:CCGGGATCCGCATCGAAGATGGAAACTCGAGTTTCCATCTTCGATGCGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018090.3-378s1c1
Sequence:CCGGCAATGTTGCATTGCAGGACCACTCGAGTGGTCCTGCAATGCAACATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_018090.3-961s21c1
Sequence:CCGGCGGGCATGTTTGGCAGTAAATCTCGAGATTTACTGCCAAACATGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_018090.3-326s21c1
Sequence:CCGGGACGGGCGTTTATTGGAATTGCTCGAGCAATTCCAATAAACGCCCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018090.3-755s21c1
Sequence:CCGGCCAAATCTACAGGATCAACTTCTCGAGAAGTTGATCCTGTAGATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_018090.3-277s21c1
Sequence:CCGGACGGATTCCAGCAGGTACTTCCTCGAGGAAGTACCTGCTGGAATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_018090.3-498s21c1
Sequence:CCGGCAAGCTCAACATCGCAAACATCTCGAGATGTTTGCGATGTTGAGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025383
VALIDATED
NECAP2 MISSION shRNA Bacterial Glycerol Stock
NECAP endocytosis associated 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025383.2-964s1c1
Sequence:CCGGCCTGAGCACAAGAAGCAGTAACTCGAGTTACTGCTTCTTGTGCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025383.2-523s1c1
Sequence:CCGGCATCGCAAACATGAGGAAGAACTCGAGTTCTTCCTCATGTTTGCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025383.2-305s1c1
Sequence:CCGGAGGTACTTCGTCATCCGAATTCTCGAGAATTCGGATGACGAAGTACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025383.2-385s1c1
Sequence:CCGGCTTTGACTTCAACGTGGCATTCTCGAGAATGCCACGTTGAAGTCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025383.2-505s1c1
Sequence:CCGGCCAGACCATCAAGATCAACATCTCGAGATGTTGATCTTGATGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025383.3-386s21c1
Sequence:CCGGCTTTGACTTCAACGTGGCATTCTCGAGAATGCCACGTTGAAGTCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025383.2-305s21c2
Sequence:CCGGAGGTACTTCGTCATCCGAATTCTCGAGAATTCGGATGACGAAGTACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025383.3-506s21c1
Sequence:CCGGCCAGACCATCAAGATCAACATCTCGAGATGTTGATCTTGATGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025383.3-967s21c1
Sequence:CCGGCCTGAGCACAAGAAGCAGTAACTCGAGTTACTGCTTCTTGTGCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025383.2-523s21c1
Sequence:CCGGCATCGCAAACATGAGGAAGAACTCGAGTTCTTCCTCATGTTTGCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025383
VALIDATED
NECAP2 MISSION shRNA shRNA Plasmid DNA
NECAP endocytosis associated 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025383.2-964s1c1
Sequence:CCGGCCTGAGCACAAGAAGCAGTAACTCGAGTTACTGCTTCTTGTGCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025383.2-523s1c1
Sequence:CCGGCATCGCAAACATGAGGAAGAACTCGAGTTCTTCCTCATGTTTGCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025383.2-305s1c1
Sequence:CCGGAGGTACTTCGTCATCCGAATTCTCGAGAATTCGGATGACGAAGTACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025383.2-385s1c1
Sequence:CCGGCTTTGACTTCAACGTGGCATTCTCGAGAATGCCACGTTGAAGTCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025383.2-505s1c1
Sequence:CCGGCCAGACCATCAAGATCAACATCTCGAGATGTTGATCTTGATGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025383.3-386s21c1
Sequence:CCGGCTTTGACTTCAACGTGGCATTCTCGAGAATGCCACGTTGAAGTCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025383.2-305s21c2
Sequence:CCGGAGGTACTTCGTCATCCGAATTCTCGAGAATTCGGATGACGAAGTACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025383.3-506s21c1
Sequence:CCGGCCAGACCATCAAGATCAACATCTCGAGATGTTGATCTTGATGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025383.3-967s21c1
Sequence:CCGGCCTGAGCACAAGAAGCAGTAACTCGAGTTACTGCTTCTTGTGCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025383.2-523s21c1
Sequence:CCGGCATCGCAAACATGAGGAAGAACTCGAGTTCTTCCTCATGTTTGCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025383
VALIDATED
NECAP2 MISSION shRNA Lentiviral Transduction Particles
NECAP endocytosis associated 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025383.2-964s1c1
Sequence:CCGGCCTGAGCACAAGAAGCAGTAACTCGAGTTACTGCTTCTTGTGCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025383.2-523s1c1
Sequence:CCGGCATCGCAAACATGAGGAAGAACTCGAGTTCTTCCTCATGTTTGCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025383.2-305s1c1
Sequence:CCGGAGGTACTTCGTCATCCGAATTCTCGAGAATTCGGATGACGAAGTACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025383.2-385s1c1
Sequence:CCGGCTTTGACTTCAACGTGGCATTCTCGAGAATGCCACGTTGAAGTCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025383.2-505s1c1
Sequence:CCGGCCAGACCATCAAGATCAACATCTCGAGATGTTGATCTTGATGGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025383.3-386s21c1
Sequence:CCGGCTTTGACTTCAACGTGGCATTCTCGAGAATGCCACGTTGAAGTCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025383.2-305s21c2
Sequence:CCGGAGGTACTTCGTCATCCGAATTCTCGAGAATTCGGATGACGAAGTACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025383.3-506s21c1
Sequence:CCGGCCAGACCATCAAGATCAACATCTCGAGATGTTGATCTTGATGGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025383.3-967s21c1
Sequence:CCGGCCTGAGCACAAGAAGCAGTAACTCGAGTTACTGCTTCTTGTGCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025383.2-523s21c1
Sequence:CCGGCATCGCAAACATGAGGAAGAACTCGAGTTCTTCCTCATGTTTGCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)