EMAIL THIS PAGE TO A FRIEND

NEDD1

neural precursor cell expressed, developmentally down-regulated 1

62 Gene Product Result for
Synonyms: GCP-WD TUBGCP7
UniProtKB ID: Q8NHV4, B0AZN0, B4E145, Q8NA30
Gene ID:
Mouse(17997) neural precursor cell expressed, developmentally down-regulated gene 1
Rat(299730) neural precursor cell expressed, developmentally down-regulated 1
Thale Cress(830483) transducin/WD40 domain-containing protein
domestic cat(101084976) neural precursor cell expressed, developmentally down-regulated 1
cow(519463) neural precursor cell expressed, developmentally down-regulated 1
Horse(100052432) neural precursor cell expressed, developmentally down-regulated 1
dog(482616) neural precursor cell expressed, developmentally down-regulated 1
chicken(417922) neural precursor cell expressed, developmentally down-regulated 1
Zebrafish(406827) neural precursor cell expressed, developmentally down-regulated 1
naked mole-rat(101726115) neural precursor cell expressed, developmentally down-regulated 1
Domestic Rabbit(100350396) neural precursor cell expressed, developmentally down-regulated 1
domestic guinea pig(100722288) neural precursor cell expressed, developmentally down-regulated 1
sheep(101122681) neural precursor cell expressed, developmentally down-regulated 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152905 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152905 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152905 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008682 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008682 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008682 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152905 Rosetta Predictions human pricing
NM_001106779 Rosetta Predictions rat pricing
NM_008682 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152905 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196861 predicted 751
2 SASI_Hs01_00196862 predicted 1039
3 SASI_Hs01_00196863 predicted 1765
4 SASI_Hs02_00366874 predicted 515
5 SASI_Hs01_00196864 predicted 854
6 SASI_Hs01_00196866 predicted 1599
7 SASI_Hs01_00196867 predicted 256
8 SASI_Hs01_00196868 predicted 1226
9 SASI_Hs01_00196869 predicted 1212
10 SASI_Hs02_00366875 predicted 809
11 SASI_Hs01_00196865 predicted 1386
12 SASI_Hs01_00196870 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106779 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222318 predicted 536
2 SASI_Rn02_00222319 predicted 912
3 SASI_Rn02_00222320 predicted 872
4 SASI_Rn02_00222321 predicted 741
5 SASI_Rn02_00222322 predicted 1780
6 SASI_Rn02_00222323 predicted 1302
7 SASI_Rn02_00222324 predicted 330
8 SASI_Rn02_00222325 predicted 1183
9 SASI_Rn02_00222326 predicted 707
10 SASI_Rn02_00222327 predicted 1046
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008682 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159597 predicted 973
2 SASI_Mm02_00314470 predicted 1045
3 SASI_Mm01_00159598 predicted 1315
4 SASI_Mm01_00159600 predicted 1699
5 SASI_Mm01_00159601 predicted 986
6 SASI_Mm01_00159602 predicted 1923
7 SASI_Mm01_00159603 predicted 794
8 SASI_Mm02_00314471 predicted 1717
9 SASI_Mm01_00159605 predicted 1996
10 SASI_Mm01_00159606 predicted 1908
11 SASI_Mm01_00159599 predicted 1112
12 SASI_Mm01_00159604 predicted 2053
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152905
VALIDATED
NEDD1 MISSION shRNA Bacterial Glycerol Stock
neural precursor cell expressed, developmentally down-regulated 1
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152905.3-839s21c1
Sequence:CCGGACTTGAAGTACTCCTTGTTTACTCGAGTAAACAAGGAGTACTTCAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152905.3-1249s21c1
Sequence:CCGGGTTCTTACTAAGTCAAGTTTACTCGAGTAAACTTGACTTAGTAAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152905.3-2179s21c1
Sequence:CCGGTTGCAAGTGGAGATGATTAAACTCGAGTTTAATCATCTCCACTTGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152905.3-2796s21c1
Sequence:CCGGCATAGGGTTGGCTAGTAATTACTCGAGTAATTACTAGCCAACCCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152905.3-749s21c1
Sequence:CCGGGATCTCTTAGTGGTGAAATTACTCGAGTAATTTCACCACTAAGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152905.3-613s21c1
Sequence:CCGGTTGGTAAGCGGAGGCCTAAATCTCGAGATTTAGGCCTCCGCTTACCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152905.3-675s21c1
Sequence:CCGGTCGATCTCTTAAGGATCATAACTCGAGTTATGATCCTTAAGAGATCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152905.3-1862s21c1
Sequence:CCGGCTGAAAGTGGAAATCTAAATACTCGAGTATTTAGATTTCCACTTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152905.3-1455s21c1
Sequence:CCGGAGGTTTGCCTCGAAGCATAAACTCGAGTTTATGCTTCGAGGCAAACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152905.3-2376s21c1
Sequence:CCGGGAACTACATAGAATCAGTATTCTCGAGAATACTGATTCTATGTAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152905.3-870s21c1
Sequence:CCGGACTGGGCAGTGTTTCGGATAACTCGAGTTATCCGAAACACTGCCCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152905.2-1597s1c1
Sequence:CCGGGTGATCTAACAGCTGAGTCTACTCGAGTAGACTCAGCTGTTAGATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_152905.2-268s1c1
Sequence:CCGGCACATGGAATCAGCTCAATATCTCGAGATATTGAGCTGATTCCATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152905.2-2094s1c1
Sequence:CCGGGTGGCTGAAATTGAAAGACTACTCGAGTAGTCTTTCAATTTCAGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_152905.2-813s1c1
Sequence:CCGGCCTGTCAATGAATTGCTCTTTCTCGAGAAAGAGCAATTCATTGACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_152905.2-1912s1c1
Sequence:CCGGCACCATTGACTTCCATTCAAACTCGAGTTTGAATGGAAGTCAATGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152905
VALIDATED
NEDD1 MISSION shRNA shRNA Plasmid DNA
neural precursor cell expressed, developmentally down-regulated 1
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152905.3-839s21c1
Sequence:CCGGACTTGAAGTACTCCTTGTTTACTCGAGTAAACAAGGAGTACTTCAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152905.3-1249s21c1
Sequence:CCGGGTTCTTACTAAGTCAAGTTTACTCGAGTAAACTTGACTTAGTAAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152905.3-2179s21c1
Sequence:CCGGTTGCAAGTGGAGATGATTAAACTCGAGTTTAATCATCTCCACTTGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152905.3-2796s21c1
Sequence:CCGGCATAGGGTTGGCTAGTAATTACTCGAGTAATTACTAGCCAACCCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152905.3-749s21c1
Sequence:CCGGGATCTCTTAGTGGTGAAATTACTCGAGTAATTTCACCACTAAGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152905.3-613s21c1
Sequence:CCGGTTGGTAAGCGGAGGCCTAAATCTCGAGATTTAGGCCTCCGCTTACCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152905.3-675s21c1
Sequence:CCGGTCGATCTCTTAAGGATCATAACTCGAGTTATGATCCTTAAGAGATCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152905.3-1862s21c1
Sequence:CCGGCTGAAAGTGGAAATCTAAATACTCGAGTATTTAGATTTCCACTTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152905.3-1455s21c1
Sequence:CCGGAGGTTTGCCTCGAAGCATAAACTCGAGTTTATGCTTCGAGGCAAACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152905.3-2376s21c1
Sequence:CCGGGAACTACATAGAATCAGTATTCTCGAGAATACTGATTCTATGTAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152905.3-870s21c1
Sequence:CCGGACTGGGCAGTGTTTCGGATAACTCGAGTTATCCGAAACACTGCCCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152905.2-1597s1c1
Sequence:CCGGGTGATCTAACAGCTGAGTCTACTCGAGTAGACTCAGCTGTTAGATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_152905.2-268s1c1
Sequence:CCGGCACATGGAATCAGCTCAATATCTCGAGATATTGAGCTGATTCCATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152905.2-2094s1c1
Sequence:CCGGGTGGCTGAAATTGAAAGACTACTCGAGTAGTCTTTCAATTTCAGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_152905.2-813s1c1
Sequence:CCGGCCTGTCAATGAATTGCTCTTTCTCGAGAAAGAGCAATTCATTGACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_152905.2-1912s1c1
Sequence:CCGGCACCATTGACTTCCATTCAAACTCGAGTTTGAATGGAAGTCAATGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152905
VALIDATED
NEDD1 MISSION shRNA Lentiviral Transduction Particles
neural precursor cell expressed, developmentally down-regulated 1
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152905.3-839s21c1
Sequence:CCGGACTTGAAGTACTCCTTGTTTACTCGAGTAAACAAGGAGTACTTCAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152905.3-1249s21c1
Sequence:CCGGGTTCTTACTAAGTCAAGTTTACTCGAGTAAACTTGACTTAGTAAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152905.3-2179s21c1
Sequence:CCGGTTGCAAGTGGAGATGATTAAACTCGAGTTTAATCATCTCCACTTGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152905.3-2796s21c1
Sequence:CCGGCATAGGGTTGGCTAGTAATTACTCGAGTAATTACTAGCCAACCCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152905.3-749s21c1
Sequence:CCGGGATCTCTTAGTGGTGAAATTACTCGAGTAATTTCACCACTAAGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152905.3-613s21c1
Sequence:CCGGTTGGTAAGCGGAGGCCTAAATCTCGAGATTTAGGCCTCCGCTTACCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152905.3-675s21c1
Sequence:CCGGTCGATCTCTTAAGGATCATAACTCGAGTTATGATCCTTAAGAGATCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152905.3-1862s21c1
Sequence:CCGGCTGAAAGTGGAAATCTAAATACTCGAGTATTTAGATTTCCACTTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152905.3-1455s21c1
Sequence:CCGGAGGTTTGCCTCGAAGCATAAACTCGAGTTTATGCTTCGAGGCAAACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152905.3-2376s21c1
Sequence:CCGGGAACTACATAGAATCAGTATTCTCGAGAATACTGATTCTATGTAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152905.3-870s21c1
Sequence:CCGGACTGGGCAGTGTTTCGGATAACTCGAGTTATCCGAAACACTGCCCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152905.2-1597s1c1
Sequence:CCGGGTGATCTAACAGCTGAGTCTACTCGAGTAGACTCAGCTGTTAGATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_152905.2-268s1c1
Sequence:CCGGCACATGGAATCAGCTCAATATCTCGAGATATTGAGCTGATTCCATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152905.2-2094s1c1
Sequence:CCGGGTGGCTGAAATTGAAAGACTACTCGAGTAGTCTTTCAATTTCAGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_152905.2-813s1c1
Sequence:CCGGCCTGTCAATGAATTGCTCTTTCTCGAGAAAGAGCAATTCATTGACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_152905.2-1912s1c1
Sequence:CCGGCACCATTGACTTCCATTCAAACTCGAGTTTGAATGGAAGTCAATGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008682
VALIDATED
NEDD1 MISSION shRNA Bacterial Glycerol Stock
neural precursor cell expressed, developmentally down-regulated 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008682.2-2659s21c1
Sequence:CCGGGAAGATTCAAGGGCTATATATCTCGAGATATATAGCCCTTGAATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008682.2-636s21c1
Sequence:CCGGTTGGGCAGCGTTTCGGATAATCTCGAGATTATCCGAAACGCTGCCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008682.2-379s21c1
Sequence:CCGGTGGCAAGTGGAGGCCTAAATACTCGAGTATTTAGGCCTCCACTTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008682.2-440s21c1
Sequence:CCGGTCGGTCTCTTAAGGATCATAACTCGAGTTATGATCCTTAAGAGACCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008682.2-340s21c1
Sequence:CCGGAGCAGACATGTGTCGATTTAACTCGAGTTAAATCGACACATGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008682.1-106s1c1
Sequence:CCGGGTTCCTGACATTGGTGGATAACTCGAGTTATCCACCAATGTCAGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008682.1-1813s1c1
Sequence:CCGGCCGCTTCATTCAGAACATGATCTCGAGATCATGTTCTGAATGAAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008682
VALIDATED
NEDD1 MISSION shRNA shRNA Plasmid DNA
neural precursor cell expressed, developmentally down-regulated 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008682.2-2659s21c1
Sequence:CCGGGAAGATTCAAGGGCTATATATCTCGAGATATATAGCCCTTGAATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008682.2-636s21c1
Sequence:CCGGTTGGGCAGCGTTTCGGATAATCTCGAGATTATCCGAAACGCTGCCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008682.2-379s21c1
Sequence:CCGGTGGCAAGTGGAGGCCTAAATACTCGAGTATTTAGGCCTCCACTTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008682.2-440s21c1
Sequence:CCGGTCGGTCTCTTAAGGATCATAACTCGAGTTATGATCCTTAAGAGACCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008682.2-340s21c1
Sequence:CCGGAGCAGACATGTGTCGATTTAACTCGAGTTAAATCGACACATGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008682.1-106s1c1
Sequence:CCGGGTTCCTGACATTGGTGGATAACTCGAGTTATCCACCAATGTCAGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008682.1-1813s1c1
Sequence:CCGGCCGCTTCATTCAGAACATGATCTCGAGATCATGTTCTGAATGAAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008682
VALIDATED
NEDD1 MISSION shRNA Lentiviral Transduction Particles
neural precursor cell expressed, developmentally down-regulated 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008682.2-2659s21c1
Sequence:CCGGGAAGATTCAAGGGCTATATATCTCGAGATATATAGCCCTTGAATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008682.2-636s21c1
Sequence:CCGGTTGGGCAGCGTTTCGGATAATCTCGAGATTATCCGAAACGCTGCCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008682.2-379s21c1
Sequence:CCGGTGGCAAGTGGAGGCCTAAATACTCGAGTATTTAGGCCTCCACTTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008682.2-440s21c1
Sequence:CCGGTCGGTCTCTTAAGGATCATAACTCGAGTTATGATCCTTAAGAGACCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008682.2-340s21c1
Sequence:CCGGAGCAGACATGTGTCGATTTAACTCGAGTTAAATCGACACATGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008682.1-106s1c1
Sequence:CCGGGTTCCTGACATTGGTGGATAACTCGAGTTATCCACCAATGTCAGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008682.1-1813s1c1
Sequence:CCGGCCGCTTCATTCAGAACATGATCTCGAGATCATGTTCTGAATGAAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)