EMAIL THIS PAGE TO A FRIEND

NEDD4

neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase

77 Gene Product Result for
Synonyms: NEDD4-1 RPF1
Gene ID:
Mouse(17999) neural precursor cell expressed, developmentally down-regulated 4
Rat(25489) neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase
sheep(101121425) neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase
domestic guinea pig(100722637) neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase
Domestic Rabbit(100009418) neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase
naked mole-rat(101712885) neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase
fruit fly(39958) CG42279 gene product from transcript CG42279-RJ
cow(507781) neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase
Horse(100054735) neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase
domestic cat(101085214) neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase
dog(608738) neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase
chicken(415406) neural precursor cell expressed, developmentally down-regulated 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_486230 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_486230 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_486230 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006154 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006154 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006154 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010890 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010890 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010890 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006154 Rosetta Predictions human pricing
NM_198400 Rosetta Predictions human pricing
NM_012986 Rosetta Predictions rat pricing
NM_010890 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006154 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011348 predicted 1647
2 SASI_Hs02_00340989 predicted 2729
3 SASI_Hs02_00340990 predicted 2078
4 SASI_Hs01_00011349 predicted 2207
5 SASI_Hs02_00340991 predicted 1151
6 SASI_Hs02_00340992 predicted 1060
7 SASI_Hs02_00340993 predicted 1164
8 SASI_Hs02_00340994 predicted 2442
9 SASI_Hs02_00340995 predicted 2472
10 SASI_Hs02_00340996 predicted 2024
11 SASI_Hs01_00011346 predicted 1595
12 SASI_Hs01_00011347 predicted 2289
13 SASI_Hs01_00011350 predicted 1599
14 SASI_Hs01_00011351 predicted 2303
15 SASI_Hs01_00011352 predicted 2158
16 SASI_Hs01_00011353 predicted 2164
17 SASI_Hs01_00011354 predicted 1589
18 SASI_Hs01_00011355 predicted 2128
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198400 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156230 predicted 2910
2 SASI_Hs02_00371917 predicted 3983
3 SASI_Hs02_00371918 predicted 3341
4 SASI_Hs01_00156231 predicted 3465
5 SASI_Hs02_00371919 predicted 2413
6 SASI_Hs02_00371920 predicted 2321
7 SASI_Hs02_00371921 predicted 2422
8 SASI_Hs02_00371922 predicted 3703
9 SASI_Hs02_00371923 predicted 3737
10 SASI_Hs02_00371924 predicted 3281
11 SASI_Hs01_00156228 predicted 2854
12 SASI_Hs01_00156229 predicted 3548
13 SASI_Hs01_00156232 predicted 2852
14 SASI_Hs01_00156233 predicted 3565
15 SASI_Hs01_00156234 predicted 3425
16 SASI_Hs01_00156235 predicted 3429
17 SASI_Hs01_00156236 predicted 2846
18 SASI_Hs01_00156237 predicted 3389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012986 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260609 predicted 1056
2 SASI_Rn02_00260610 predicted 310
3 SASI_Rn02_00260611 predicted 537
4 SASI_Rn02_00260612 predicted 1895
5 SASI_Rn02_00260613 predicted 633
6 SASI_Rn02_00260614 predicted 2525
7 SASI_Rn02_00260615 predicted 857
8 SASI_Rn02_00260616 predicted 2655
9 SASI_Rn02_00260617 predicted 858
10 SASI_Rn02_00260618 predicted 1842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010890 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183736 predicted 1001
2 SASI_Mm01_00183737 predicted 1166
3 SASI_Mm01_00183738 predicted 1574
4 SASI_Mm01_00183740 predicted 880
5 SASI_Mm01_00183741 predicted 2030
6 SASI_Mm02_00319594 predicted 516
7 SASI_Mm01_00183742 predicted 501
8 SASI_Mm01_00183743 predicted 2367
9 SASI_Mm01_00183744 predicted 1206
10 SASI_Mm01_00183745 predicted 2383
11 SASI_Mm01_00183739 predicted 1472
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_486230
NEDD4 MISSION shRNA Bacterial Glycerol Stock
neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_486230.1-3588s1c1
Sequence:CCGGGCGACATACTTAGTACCACATCTCGAGATGTGGTACTAAGTATGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486230.1-37s1c1
Sequence:CCGGCAGAAACAACAGCATTGTGAACTCGAGTTCACAATGCTGTTGTTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486230.1-1319s1c1
Sequence:CCGGCCTACTACGTAAACCATGAATCTCGAGATTCATGGTTTACGTAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486230.1-2132s1c1
Sequence:CCGGGCGCAAACATTCTGGAGGATTCTCGAGAATCCTCCAGAATGTTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486230.1-2082s1c1
Sequence:CCGGGCTCAAGAAGCAGACTGACATCTCGAGATGTCAGTCTGCTTCTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_486230
NEDD4 MISSION shRNA shRNA Plasmid DNA
neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_486230.1-3588s1c1
Sequence:CCGGGCGACATACTTAGTACCACATCTCGAGATGTGGTACTAAGTATGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486230.1-37s1c1
Sequence:CCGGCAGAAACAACAGCATTGTGAACTCGAGTTCACAATGCTGTTGTTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486230.1-1319s1c1
Sequence:CCGGCCTACTACGTAAACCATGAATCTCGAGATTCATGGTTTACGTAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486230.1-2132s1c1
Sequence:CCGGGCGCAAACATTCTGGAGGATTCTCGAGAATCCTCCAGAATGTTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486230.1-2082s1c1
Sequence:CCGGGCTCAAGAAGCAGACTGACATCTCGAGATGTCAGTCTGCTTCTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_486230
NEDD4 MISSION shRNA Lentiviral Transduction Particles
neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_486230.1-3588s1c1
Sequence:CCGGGCGACATACTTAGTACCACATCTCGAGATGTGGTACTAAGTATGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486230.1-37s1c1
Sequence:CCGGCAGAAACAACAGCATTGTGAACTCGAGTTCACAATGCTGTTGTTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486230.1-1319s1c1
Sequence:CCGGCCTACTACGTAAACCATGAATCTCGAGATTCATGGTTTACGTAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486230.1-2132s1c1
Sequence:CCGGGCGCAAACATTCTGGAGGATTCTCGAGAATCCTCCAGAATGTTTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486230.1-2082s1c1
Sequence:CCGGGCTCAAGAAGCAGACTGACATCTCGAGATGTCAGTCTGCTTCTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006154
VALIDATED
NEDD4 MISSION shRNA Bacterial Glycerol Stock
neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006154.1-3522s1c1
Sequence:CCGGGCCTTTCTCTTGCCTGCATATCTCGAGATATGCAGGCAAGAGAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006154.1-941s1c1
Sequence:CCGGCCGTCAAGTAACTTGGATGTTCTCGAGAACATCCAAGTTACTTGACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006154.1-1753s1c1
Sequence:CCGGCCGGAGAATTATGGGTGTCAACTCGAGTTGACACCCATAATTCTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006154.1-2597s1c1
Sequence:CCGGGCTGAACTATACGGTTCAAATCTCGAGATTTGAACCGTATAGTTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006154.1-1595s1c1
Sequence:CCGGCGGTTGGAGAATGTAGCAATACTCGAGTATTGCTACATTCTCCAACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006154.2-795s21c1
Sequence:GTACCGGTGCAAGCACAACGTGCATTTACTCGAGTAAATGCACGTTGTGCTTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006154.2-2699s21c1
Sequence:GTACCGGTTGCCACCTTATGAATCATTTCTCGAGAAATGATTCATAAGGTGGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006154.2-1876s21c1
Sequence:GTACCGGGGAAATGTTTAACCCTTATTACTCGAGTAATAAGGGTTAAACATTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006154.2-2597s21c1
Sequence:CCGGGCTGAACTATACGGTTCAAATCTCGAGATTTGAACCGTATAGTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006154.2-1595s21c1
Sequence:CCGGCGGTTGGAGAATGTAGCAATACTCGAGTATTGCTACATTCTCCAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006154.2-3280s21c1
Sequence:CCGGAGTGCTACTCGCAGCTATTTACTCGAGTAAATAGCTGCGAGTAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006154.2-209s21c1
Sequence:CCGGTACGTGAGAGTGACGTTATATCTCGAGATATAACGTCACTCTCACGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006154.2-1753s21c1
Sequence:CCGGCCGGAGAATTATGGGTGTCAACTCGAGTTGACACCCATAATTCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006154.2-3051s21c1
Sequence:GTACCGGAGTTCACACAATAGGATATAACTCGAGTTATATCCTATTGTGTGAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006154
VALIDATED
NEDD4 MISSION shRNA shRNA Plasmid DNA
neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006154.1-3522s1c1
Sequence:CCGGGCCTTTCTCTTGCCTGCATATCTCGAGATATGCAGGCAAGAGAAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006154.1-941s1c1
Sequence:CCGGCCGTCAAGTAACTTGGATGTTCTCGAGAACATCCAAGTTACTTGACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006154.1-1753s1c1
Sequence:CCGGCCGGAGAATTATGGGTGTCAACTCGAGTTGACACCCATAATTCTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006154.1-2597s1c1
Sequence:CCGGGCTGAACTATACGGTTCAAATCTCGAGATTTGAACCGTATAGTTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006154.1-1595s1c1
Sequence:CCGGCGGTTGGAGAATGTAGCAATACTCGAGTATTGCTACATTCTCCAACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006154.2-795s21c1
Sequence:GTACCGGTGCAAGCACAACGTGCATTTACTCGAGTAAATGCACGTTGTGCTTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006154.2-2699s21c1
Sequence:GTACCGGTTGCCACCTTATGAATCATTTCTCGAGAAATGATTCATAAGGTGGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006154.2-1876s21c1
Sequence:GTACCGGGGAAATGTTTAACCCTTATTACTCGAGTAATAAGGGTTAAACATTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006154.2-2597s21c1
Sequence:CCGGGCTGAACTATACGGTTCAAATCTCGAGATTTGAACCGTATAGTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006154.2-1595s21c1
Sequence:CCGGCGGTTGGAGAATGTAGCAATACTCGAGTATTGCTACATTCTCCAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006154.2-3280s21c1
Sequence:CCGGAGTGCTACTCGCAGCTATTTACTCGAGTAAATAGCTGCGAGTAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006154.2-209s21c1
Sequence:CCGGTACGTGAGAGTGACGTTATATCTCGAGATATAACGTCACTCTCACGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006154.2-1753s21c1
Sequence:CCGGCCGGAGAATTATGGGTGTCAACTCGAGTTGACACCCATAATTCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006154.2-3051s21c1
Sequence:GTACCGGAGTTCACACAATAGGATATAACTCGAGTTATATCCTATTGTGTGAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006154
VALIDATED
NEDD4 MISSION shRNA Lentiviral Transduction Particles
neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006154.1-3522s1c1
Sequence:CCGGGCCTTTCTCTTGCCTGCATATCTCGAGATATGCAGGCAAGAGAAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006154.1-941s1c1
Sequence:CCGGCCGTCAAGTAACTTGGATGTTCTCGAGAACATCCAAGTTACTTGACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006154.1-1753s1c1
Sequence:CCGGCCGGAGAATTATGGGTGTCAACTCGAGTTGACACCCATAATTCTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006154.1-2597s1c1
Sequence:CCGGGCTGAACTATACGGTTCAAATCTCGAGATTTGAACCGTATAGTTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006154.1-1595s1c1
Sequence:CCGGCGGTTGGAGAATGTAGCAATACTCGAGTATTGCTACATTCTCCAACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006154.2-795s21c1
Sequence:GTACCGGTGCAAGCACAACGTGCATTTACTCGAGTAAATGCACGTTGTGCTTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006154.2-2699s21c1
Sequence:GTACCGGTTGCCACCTTATGAATCATTTCTCGAGAAATGATTCATAAGGTGGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006154.2-1876s21c1
Sequence:GTACCGGGGAAATGTTTAACCCTTATTACTCGAGTAATAAGGGTTAAACATTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006154.2-2597s21c1
Sequence:CCGGGCTGAACTATACGGTTCAAATCTCGAGATTTGAACCGTATAGTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006154.2-1595s21c1
Sequence:CCGGCGGTTGGAGAATGTAGCAATACTCGAGTATTGCTACATTCTCCAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006154.2-3280s21c1
Sequence:CCGGAGTGCTACTCGCAGCTATTTACTCGAGTAAATAGCTGCGAGTAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006154.2-209s21c1
Sequence:CCGGTACGTGAGAGTGACGTTATATCTCGAGATATAACGTCACTCTCACGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006154.2-1753s21c1
Sequence:CCGGCCGGAGAATTATGGGTGTCAACTCGAGTTGACACCCATAATTCTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006154.2-3051s21c1
Sequence:GTACCGGAGTTCACACAATAGGATATAACTCGAGTTATATCCTATTGTGTGAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010890
NEDD4 MISSION shRNA Bacterial Glycerol Stock
neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000367981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010890.3-445s21c1
Sequence:CCGGGTTGTGAGAGTGAAGGTTATACTCGAGTATAACCTTCACTCTCACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010890.3-1998s21c1
Sequence:CCGGATATTCTGCTACGGATAATTACTCGAGTAATTATCCGTAGCAGAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010890.3-2858s21c1
Sequence:CCGGTTGATGGCGTTGATTAGATTACTCGAGTAATCTAATCAACGCCATCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010890.3-1833s21c1
Sequence:CCGGGGATTCTTACCGGAGGATTATCTCGAGATAATCCTCCGGTAAGAATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010890
NEDD4 MISSION shRNA shRNA Plasmid DNA
neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000367981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010890.3-445s21c1
Sequence:CCGGGTTGTGAGAGTGAAGGTTATACTCGAGTATAACCTTCACTCTCACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010890.3-1998s21c1
Sequence:CCGGATATTCTGCTACGGATAATTACTCGAGTAATTATCCGTAGCAGAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010890.3-2858s21c1
Sequence:CCGGTTGATGGCGTTGATTAGATTACTCGAGTAATCTAATCAACGCCATCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010890.3-1833s21c1
Sequence:CCGGGGATTCTTACCGGAGGATTATCTCGAGATAATCCTCCGGTAAGAATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010890
NEDD4 MISSION shRNA Lentiviral Transduction Particles
neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000367981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010890.3-445s21c1
Sequence:CCGGGTTGTGAGAGTGAAGGTTATACTCGAGTATAACCTTCACTCTCACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010890.3-1998s21c1
Sequence:CCGGATATTCTGCTACGGATAATTACTCGAGTAATTATCCGTAGCAGAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010890.3-2858s21c1
Sequence:CCGGTTGATGGCGTTGATTAGATTACTCGAGTAATCTAATCAACGCCATCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010890.3-1833s21c1
Sequence:CCGGGGATTCTTACCGGAGGATTATCTCGAGATAATCCTCCGGTAAGAATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)