EMAIL THIS PAGE TO A FRIEND

NEDD9

neural precursor cell expressed, developmentally down-regulated 9

181 Gene Product Result for
Synonyms: CAS-L CAS2 CASL CASS2 HEF1
UniProtKB ID: Q14511, A8K9G7, A8MSJ9, G5E9Y9, Q5T9R4, Q5XKI0
Gene ID:
Human(4739) Summary: The protein encoded by this gene is a member of the CRK-associated substrates family. Members of this family are adhesion docking molecules that mediate protein-protein interactions for signal transduction pathways. This protein is a focal adhesion protein that acts as a scaffold to regulate signaling complexes important in cell attachment, migration and invasion as well as apoptosis and the cell cycle. This protein has also been reported to have a role in cancer metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Mouse(18003) neural precursor cell expressed, developmentally down-regulated gene 9
Rat(291044) neural precursor cell expressed, developmentally down-regulated 9
Zebrafish(768136) neural precursor cell expressed, developmentally down-regulated 9
chicken(395736) neural precursor cell expressed, developmentally down-regulated 9
cow(504967) neural precursor cell expressed, developmentally down-regulated 9
Horse(100063890) neural precursor cell expressed, developmentally down-regulated 9
domestic cat(101091446) neural precursor cell expressed, developmentally down-regulated 9
dog(488220) neural precursor cell expressed, developmentally down-regulated 9
naked mole-rat(101698216) neural precursor cell expressed, developmentally down-regulated 9
domestic guinea pig(100716070) neural precursor cell expressed, developmentally down-regulated 9
sheep(101105289) neural precursor cell expressed, developmentally down-regulated 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
N9539 Anti-Nedd9 (C-terminal region) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB4200076 Anti-Nedd9 (C-terminal) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, western blot pricing
SAB2500679 Anti-NEDD9 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, canine, mouse, human
ELISA, western blot pricing
SAB1406174 Anti-NEDD9 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB4200212 Anti-Nedd9 antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody human
western blot pricing
SAB2101563 Anti-NEDD9 antibody produced in rabbit affinity isolated antibody mouse, rabbit, human, guinea pig, rat
immunohistochemistry, western blot pricing
HPA038768 Anti-NEDD9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA039270 Anti-NEDD9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB3701434 Monoclonal Anti-HEF1 (aa 82-398) antibody produced in mouse clone 14A11, purified immunoglobulin human
ELISA, immunoprecipitation (IP), western blot pricing
SAB3701433 Monoclonal Anti-HEF1 (aa 82-398) antibody produced in mouse clone 2G9, purified immunoglobulin human
ELISA, immunoprecipitation (IP), western blot pricing
WH0004739M1 Monoclonal Anti-NEDD9 antibody produced in mouse clone 1B4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1404115 Monoclonal Anti-NEDD9 antibody produced in mouse clone 1B4, ascites fluid human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017464 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017464 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017464 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006403 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006403 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006403 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU089381 MISSION® esiRNA esiRNA human NEDD9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006403 Rosetta Predictions human pricing
NM_182966 Rosetta Predictions human pricing
NM_001011922 Rosetta Predictions rat pricing
XM_574000 Rosetta Predictions rat pricing
NM_001111324 Rosetta Predictions mouse pricing
NM_017464 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006403 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191226 predicted 275
2 SASI_Hs01_00191227 predicted 323
3 SASI_Hs01_00191228 predicted 380
4 SASI_Hs01_00191229 predicted 227
5 SASI_Hs01_00191230 predicted 313
6 SASI_Hs01_00191231 predicted 327
7 SASI_Hs01_00191232 predicted 319
8 SASI_Hs01_00191233 predicted 288
9 SASI_Hs01_00191234 predicted 212
10 SASI_Hs01_00191235 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182966 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129626 predicted 256
2 SASI_Hs01_00129627 predicted 306
3 SASI_Hs01_00129628 predicted 356
4 SASI_Hs01_00129629 predicted 216
5 SASI_Hs01_00129630 predicted 304
6 SASI_Hs01_00129631 predicted 316
7 SASI_Hs01_00129632 predicted 295
8 SASI_Hs01_00129633 predicted 268
9 SASI_Hs01_00129634 predicted 202
10 SASI_Hs01_00129635 predicted 304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011922 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063167 predicted 2549
2 SASI_Rn02_00199920 predicted 2461
3 SASI_Rn01_00063168 predicted 2091
4 SASI_Rn01_00063169 predicted 814
5 SASI_Rn01_00063170 predicted 2516
6 SASI_Rn01_00063172 predicted 1065
7 SASI_Rn02_00199921 predicted 1124
8 SASI_Rn02_00199922 predicted 1729
9 SASI_Rn01_00063174 predicted 831
10 SASI_Rn02_00199923 predicted 1829
11 SASI_Rn01_00063165 predicted 271
12 SASI_Rn01_00063166 predicted 451
13 SASI_Rn01_00063171 predicted 2610
14 SASI_Rn01_00063173 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574000 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00127372 predicted 268
2 SASI_Rn01_00127373 predicted 444
3 SASI_Rn01_00127374 predicted 2555
4 SASI_Rn01_00127375 predicted 2098
5 SASI_Rn01_00127376 predicted 825
6 SASI_Rn01_00127377 predicted 2526
7 SASI_Rn01_00127378 predicted 2612
8 SASI_Rn01_00127379 predicted 1070
9 SASI_Rn01_00127380 predicted 407
10 SASI_Rn01_00127381 predicted 835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111324 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306832 predicted 727
2 SASI_Mm02_00306833 predicted 2674
3 SASI_Mm02_00306834 predicted 1901
4 SASI_Mm02_00306835 predicted 2550
5 SASI_Mm02_00306836 predicted 1664
6 SASI_Mm02_00306837 predicted 1396
7 SASI_Mm02_00306838 predicted 1144
8 SASI_Mm02_00306839 predicted 2180
9 SASI_Mm02_00306840 predicted 1939
10 SASI_Mm02_00306841 predicted 1799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017464 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084625 predicted 546
2 SASI_Mm01_00084626 predicted 2498
3 SASI_Mm01_00084627 predicted 1714
4 SASI_Mm02_00323925 predicted 2372
5 SASI_Mm01_00084628 predicted 1487
6 SASI_Mm01_00084629 predicted 1217
7 SASI_Mm01_00084632 predicted 964
8 SASI_Mm01_00084633 predicted 2000
9 SASI_Mm01_00084634 predicted 1763
10 SASI_Mm02_00323926 predicted 1614
11 SASI_Mm01_00084630 predicted 1709
12 SASI_Mm01_00084631 predicted 2731
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017464
NEDD9 MISSION shRNA Bacterial Glycerol Stock
neural precursor cell expressed, developmentally down-regulated 9
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017464.2-613s1c1
Sequence:CCGGCCTACCAGAATCAGGGAATTTCTCGAGAAATTCCCTGATTCTGGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017464.5-2798s21c1
Sequence:CCGGAGCTGAAGCTTGGATTTATTTCTCGAGAAATAAATCCAAGCTTCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009791    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017464.2-4210s1c1
Sequence:CCGGGCTGAGCTATTGGAGAGCAATCTCGAGATTGCTCTCCAATAGCTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017464.2-2396s1c1
Sequence:CCGGGCAGTTGCTTTGCTTCTACTACTCGAGTAGTAGAAGCAAAGCAACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017464.2-1765s1c1
Sequence:CCGGCCCACCAGATTCTAAGCCAAACTCGAGTTTGGCTTAGAATCTGGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017464.2-2538s1c1
Sequence:CCGGGCGCACAAACTGGTGTTCATTCTCGAGAATGAACACCAGTTTGTGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017464.5-208s21c1
Sequence:CCGGTCCGCAAGGGAGACATCTTAACTCGAGTTAAGATGTCTCCCTTGCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017464.5-1499s21c1
Sequence:CCGGAGAGCTGTTCTTACGAGAATACTCGAGTATTCTCGTAAGAACAGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017464
NEDD9 MISSION shRNA shRNA Plasmid DNA
neural precursor cell expressed, developmentally down-regulated 9
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017464.2-613s1c1
Sequence:CCGGCCTACCAGAATCAGGGAATTTCTCGAGAAATTCCCTGATTCTGGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017464.5-2798s21c1
Sequence:CCGGAGCTGAAGCTTGGATTTATTTCTCGAGAAATAAATCCAAGCTTCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009791    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017464.2-4210s1c1
Sequence:CCGGGCTGAGCTATTGGAGAGCAATCTCGAGATTGCTCTCCAATAGCTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017464.2-2396s1c1
Sequence:CCGGGCAGTTGCTTTGCTTCTACTACTCGAGTAGTAGAAGCAAAGCAACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017464.2-1765s1c1
Sequence:CCGGCCCACCAGATTCTAAGCCAAACTCGAGTTTGGCTTAGAATCTGGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017464.2-2538s1c1
Sequence:CCGGGCGCACAAACTGGTGTTCATTCTCGAGAATGAACACCAGTTTGTGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017464.5-208s21c1
Sequence:CCGGTCCGCAAGGGAGACATCTTAACTCGAGTTAAGATGTCTCCCTTGCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017464.5-1499s21c1
Sequence:CCGGAGAGCTGTTCTTACGAGAATACTCGAGTATTCTCGTAAGAACAGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017464
NEDD9 MISSION shRNA Lentiviral Transduction Particles
neural precursor cell expressed, developmentally down-regulated 9
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017464.2-613s1c1
Sequence:CCGGCCTACCAGAATCAGGGAATTTCTCGAGAAATTCCCTGATTCTGGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017464.5-2798s21c1
Sequence:CCGGAGCTGAAGCTTGGATTTATTTCTCGAGAAATAAATCCAAGCTTCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009791    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017464.2-4210s1c1
Sequence:CCGGGCTGAGCTATTGGAGAGCAATCTCGAGATTGCTCTCCAATAGCTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017464.2-2396s1c1
Sequence:CCGGGCAGTTGCTTTGCTTCTACTACTCGAGTAGTAGAAGCAAAGCAACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017464.2-1765s1c1
Sequence:CCGGCCCACCAGATTCTAAGCCAAACTCGAGTTTGGCTTAGAATCTGGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017464.2-2538s1c1
Sequence:CCGGGCGCACAAACTGGTGTTCATTCTCGAGAATGAACACCAGTTTGTGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017464.5-208s21c1
Sequence:CCGGTCCGCAAGGGAGACATCTTAACTCGAGTTAAGATGTCTCCCTTGCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017464.5-1499s21c1
Sequence:CCGGAGAGCTGTTCTTACGAGAATACTCGAGTATTCTCGTAAGAACAGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006403
NEDD9 MISSION shRNA Bacterial Glycerol Stock
neural precursor cell expressed, developmentally down-regulated 9
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006403.2-2508s1c1
Sequence:CCGGGCAGCTCAAGACCATAGTCATCTCGAGATGACTATGGTCTTGAGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004967    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006403.2-4004s1c1
Sequence:CCGGGCCCAGTTCTTATTTAGCATTCTCGAGAATGCTAAATAAGAACTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006403.2-181s1c1
Sequence:CCGGGCCTTATATGACAATGTCCCACTCGAGTGGGACATTGTCATATAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006403.2-2190s1c1
Sequence:CCGGCGTGGAGAATGACATCTCGAACTCGAGTTCGAGATGTCATTCTCCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006403.2-1689s1c1
Sequence:CCGGCCTGAATATCTTGGCCATCAACTCGAGTTGATGGCCAAGATATTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006403
NEDD9 MISSION shRNA shRNA Plasmid DNA
neural precursor cell expressed, developmentally down-regulated 9
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006403.2-2508s1c1
Sequence:CCGGGCAGCTCAAGACCATAGTCATCTCGAGATGACTATGGTCTTGAGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004967    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006403.2-4004s1c1
Sequence:CCGGGCCCAGTTCTTATTTAGCATTCTCGAGAATGCTAAATAAGAACTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006403.2-181s1c1
Sequence:CCGGGCCTTATATGACAATGTCCCACTCGAGTGGGACATTGTCATATAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006403.2-2190s1c1
Sequence:CCGGCGTGGAGAATGACATCTCGAACTCGAGTTCGAGATGTCATTCTCCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006403.2-1689s1c1
Sequence:CCGGCCTGAATATCTTGGCCATCAACTCGAGTTGATGGCCAAGATATTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006403
NEDD9 MISSION shRNA Lentiviral Transduction Particles
neural precursor cell expressed, developmentally down-regulated 9
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006403.2-2508s1c1
Sequence:CCGGGCAGCTCAAGACCATAGTCATCTCGAGATGACTATGGTCTTGAGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004967    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006403.2-4004s1c1
Sequence:CCGGGCCCAGTTCTTATTTAGCATTCTCGAGAATGCTAAATAAGAACTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006403.2-181s1c1
Sequence:CCGGGCCTTATATGACAATGTCCCACTCGAGTGGGACATTGTCATATAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006403.2-2190s1c1
Sequence:CCGGCGTGGAGAATGACATCTCGAACTCGAGTTCGAGATGTCATTCTCCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006403.2-1689s1c1
Sequence:CCGGCCTGAATATCTTGGCCATCAACTCGAGTTGATGGCCAAGATATTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)