EMAIL THIS PAGE TO A FRIEND

NEFH

neurofilament, heavy polypeptide

118 Gene Product Result for
Synonyms: NFH
UniProtKB ID: P12036, B4DYY4, Q96HF8, Q9UJS7, Q9UQ14
Gene ID:
Human(4744) Summary: Neurofilaments are type IV intermediate filament heteropolymers composed of light, medium, and heavy chains. Neurofilaments comprise the axoskeleton and functionally maintain neuronal caliber. They may also play a role in intracellular transport to axons and dendrites. This gene encodes the heavy neurofilament protein. This protein is commonly used as a biomarker of neuronal damage and susceptibility to amyotrophic lateral sclerosis (ALS) has been associated with mutations in this gene. [provided by RefSeq, Oct 2008]
Mouse(380684) neurofilament, heavy polypeptide
Rat(24587) neurofilament, heavy polypeptide
chicken(417020) neurofilament, heavy polypeptide
cow(528842) neurofilament, heavy polypeptide
domestic cat(101087272) neurofilament, heavy polypeptide
dog(442940) neurofilament, heavy polypeptide
sheep(101107472) neurofilament, heavy polypeptide
domestic guinea pig(100716406) neurofilament, heavy polypeptide
naked mole-rat(101704170) neurofilament, heavy polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA052084 Anti-AC008132.13 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA052542 Anti-FAM27C antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA061615 Anti-NEFH antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
N4142 Anti-Neurofilament 200 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution wide range, bovine
immunohistochemistry, microarray, western blot pricing
HPA053929 Anti-TEKT4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
WH0004744M1 Monoclonal Anti-NEFH antibody produced in mouse clone 2E8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
AMAB91025 Monoclonal Anti-NEFH antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL2671, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
N2912 Monoclonal Anti-Neurofilament 160/200 antibody produced in mouse ~2 mg/mL, clone RMdO20, purified immunoglobulin, buffered aqueous solution rat, human, mouse
immunocytochemistry, immunohistochemistry, microarray, western blot pricing
N0142 Monoclonal Anti-Neurofilament 200 (Phos. and Non-Phos.) antibody produced in mouse clone N52, ascites fluid wide range
immunohistochemistry, microarray, western blot pricing
N5389 Monoclonal Anti-Neurofilament 200 antibody produced in mouse clone NE14, ascites fluid chicken, human, bovine, guinea pig, rabbit, pig, rat, mouse
immunohistochemistry, microarray, western blot pricing
SAB4701005 Monoclonal Anti-Neurofilament H antibody produced in mouse clone NF-05 New western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021076 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021076 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021076 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010904 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010904 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010904 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021076 Rosetta Predictions human pricing
NM_012607 Rosetta Predictions rat pricing
NM_010904 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021076 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156349 predicted 2988
2 SASI_Hs01_00156351 predicted 3102
3 SASI_Hs01_00156353 predicted 2283
4 SASI_Hs01_00156355 predicted 2684
5 SASI_Hs02_00354562 predicted 3144
6 SASI_Hs02_00354563 predicted 3099
7 SASI_Hs02_00354564 predicted 2686
8 SASI_Hs01_00156352 predicted 2114
9 SASI_Hs02_00354565 predicted 2243
10 SASI_Hs02_00354566 predicted 3121
11 SASI_Hs01_00156350 predicted 3191
12 SASI_Hs01_00156354 predicted 1957
13 SASI_Hs01_00156356 predicted 2305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012607 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037044 predicted 1959
2 SASI_Rn02_00259785 predicted 2978
3 SASI_Rn02_00259786 predicted 3130
4 SASI_Rn02_00259787 predicted 2008
5 SASI_Rn02_00259788 predicted 2972
6 SASI_Rn02_00259789 predicted 3288
7 SASI_Rn02_00259790 predicted 3301
8 SASI_Rn02_00259791 predicted 1131
9 SASI_Rn02_00259792 predicted 2289
10 SASI_Rn01_00037040 predicted 2099
11 SASI_Rn01_00037041 predicted 2048
12 SASI_Rn01_00037042 predicted 2323
13 SASI_Rn01_00037043 predicted 1246
14 SASI_Rn01_00037045 predicted 1129
15 SASI_Rn01_00037046 predicted 1731
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010904 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028093 predicted 2958
2 SASI_Mm01_00028094 predicted 3287
3 SASI_Mm01_00028095 predicted 3048
4 SASI_Mm01_00028096 predicted 3049
5 SASI_Mm01_00028097 predicted 2928
6 SASI_Mm01_00028098 predicted 3422
7 SASI_Mm01_00028099 predicted 1204
8 SASI_Mm01_00028100 predicted 2408
9 SASI_Mm01_00028101 predicted 1301
10 SASI_Mm02_00319626 predicted 1187
11 SASI_Mm01_00028102 predicted 3252
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021076
NEFH MISSION shRNA Bacterial Glycerol Stock
neurofilament, heavy polypeptide
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021076.3-3403s21c1
Sequence:CCGGACGTAAACACTTGACTATAAACTCGAGTTTATAGTCAAGTGTTTACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021076.3-3351s21c1
Sequence:CCGGTGGACAATTATGATAGCTTATCTCGAGATAAGCTATCATAATTGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021076.2-1420s1c1
Sequence:CCGGGAGACCCAAGTGACTGAAGAACTCGAGTTCTTCAGTCACTTGGGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021076.2-2818s1c1
Sequence:CCGGGCCAAGAAGGAACCAGATGATCTCGAGATCATCTGGTTCCTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021076.2-2776s1c1
Sequence:CCGGGAGGTGAAGGAAGACGCTAAACTCGAGTTTAGCGTCTTCCTTCACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021076.2-945s1c1
Sequence:CCGGCAAGGTGAACACAGACGCTATCTCGAGATAGCGTCTGTGTTCACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021076.2-2362s1c1
Sequence:CCGGCCTGCAGACAAATTCCCTGAACTCGAGTTCAGGGAATTTGTCTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021076
NEFH MISSION shRNA shRNA Plasmid DNA
neurofilament, heavy polypeptide
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021076.3-3403s21c1
Sequence:CCGGACGTAAACACTTGACTATAAACTCGAGTTTATAGTCAAGTGTTTACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021076.3-3351s21c1
Sequence:CCGGTGGACAATTATGATAGCTTATCTCGAGATAAGCTATCATAATTGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021076.2-1420s1c1
Sequence:CCGGGAGACCCAAGTGACTGAAGAACTCGAGTTCTTCAGTCACTTGGGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021076.2-2818s1c1
Sequence:CCGGGCCAAGAAGGAACCAGATGATCTCGAGATCATCTGGTTCCTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021076.2-2776s1c1
Sequence:CCGGGAGGTGAAGGAAGACGCTAAACTCGAGTTTAGCGTCTTCCTTCACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021076.2-945s1c1
Sequence:CCGGCAAGGTGAACACAGACGCTATCTCGAGATAGCGTCTGTGTTCACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021076.2-2362s1c1
Sequence:CCGGCCTGCAGACAAATTCCCTGAACTCGAGTTCAGGGAATTTGTCTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021076
NEFH MISSION shRNA Lentiviral Transduction Particles
neurofilament, heavy polypeptide
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021076.3-3403s21c1
Sequence:CCGGACGTAAACACTTGACTATAAACTCGAGTTTATAGTCAAGTGTTTACGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021076.3-3351s21c1
Sequence:CCGGTGGACAATTATGATAGCTTATCTCGAGATAAGCTATCATAATTGTCCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021076.2-1420s1c1
Sequence:CCGGGAGACCCAAGTGACTGAAGAACTCGAGTTCTTCAGTCACTTGGGTCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021076.2-2818s1c1
Sequence:CCGGGCCAAGAAGGAACCAGATGATCTCGAGATCATCTGGTTCCTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021076.2-2776s1c1
Sequence:CCGGGAGGTGAAGGAAGACGCTAAACTCGAGTTTAGCGTCTTCCTTCACCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021076.2-945s1c1
Sequence:CCGGCAAGGTGAACACAGACGCTATCTCGAGATAGCGTCTGTGTTCACCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021076.2-2362s1c1
Sequence:CCGGCCTGCAGACAAATTCCCTGAACTCGAGTTCAGGGAATTTGTCTGCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010904
NEFH MISSION shRNA Bacterial Glycerol Stock
neurofilament, heavy polypeptide
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010904.2-1435s1c1
Sequence:CCGGCCCTCCATATCCACGCACATACTCGAGTATGTGCGTGGATATGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010904.2-3729s1c1
Sequence:CCGGCGCAATAATGAATGAGCAGTTCTCGAGAACTGCTCATTCATTATTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010904.2-1089s1c1
Sequence:CCGGCCAAGAGGAGATAACTGAGTACTCGAGTACTCAGTTATCTCCTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010904.2-1436s1c1
Sequence:CCGGCCTCCATATCCACGCACATAACTCGAGTTATGTGCGTGGATATGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010904.2-3250s1c1
Sequence:CCGGCTTTCCAAAGAGCCTAGCAAACTCGAGTTTGCTAGGCTCTTTGGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010904
NEFH MISSION shRNA shRNA Plasmid DNA
neurofilament, heavy polypeptide
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010904.2-1435s1c1
Sequence:CCGGCCCTCCATATCCACGCACATACTCGAGTATGTGCGTGGATATGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010904.2-3729s1c1
Sequence:CCGGCGCAATAATGAATGAGCAGTTCTCGAGAACTGCTCATTCATTATTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010904.2-1089s1c1
Sequence:CCGGCCAAGAGGAGATAACTGAGTACTCGAGTACTCAGTTATCTCCTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010904.2-1436s1c1
Sequence:CCGGCCTCCATATCCACGCACATAACTCGAGTTATGTGCGTGGATATGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010904.2-3250s1c1
Sequence:CCGGCTTTCCAAAGAGCCTAGCAAACTCGAGTTTGCTAGGCTCTTTGGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010904
NEFH MISSION shRNA Lentiviral Transduction Particles
neurofilament, heavy polypeptide
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010904.2-1435s1c1
Sequence:CCGGCCCTCCATATCCACGCACATACTCGAGTATGTGCGTGGATATGGAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010904.2-3729s1c1
Sequence:CCGGCGCAATAATGAATGAGCAGTTCTCGAGAACTGCTCATTCATTATTGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010904.2-1089s1c1
Sequence:CCGGCCAAGAGGAGATAACTGAGTACTCGAGTACTCAGTTATCTCCTCTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010904.2-1436s1c1
Sequence:CCGGCCTCCATATCCACGCACATAACTCGAGTTATGTGCGTGGATATGGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010904.2-3250s1c1
Sequence:CCGGCTTTCCAAAGAGCCTAGCAAACTCGAGTTTGCTAGGCTCTTTGGAAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)