EMAIL THIS PAGE TO A FRIEND

NEFL

neurofilament, light polypeptide

146 Gene Product Result for
Synonyms: CMT1F CMT2E NF-L NF68 NFL
UniProtKB ID: P07196, B9ZVN2, Q16154, Q8IU72
Gene ID:
Human(4747) Summary: Neurofilaments are type IV intermediate filament heteropolymers composed of light, medium, and heavy chains. Neurofilaments comprise the axoskeleton and they functionally maintain the neuronal caliber. They may also play a role in intracellular transport to axons and dendrites. This gene encodes the light chain neurofilament protein. Mutations in this gene cause Charcot-Marie-Tooth disease types 1F (CMT1F) and 2E (CMT2E), disorders of the peripheral nervous system that are characterized by distinct neuropathies. A pseudogene has been identified on chromosome Y. [provided by RefSeq, Oct 2008]
Mouse(18039) neurofilament, light polypeptide
Rat(83613) neurofilament, light polypeptide
chicken(419528) neurofilament, light polypeptide
cow(281348) neurofilament, light polypeptide
domestic cat(101081039) neurofilament, light polypeptide
dog(477378) neurofilament, light polypeptide
naked mole-rat(101704332) neurofilament, light polypeptide
domestic guinea pig(100731797) neurofilament, light polypeptide
sheep(101119539) neurofilament, light polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1406176 Anti-NEFL antibody produced in mouse purified immunoglobulin, buffered aqueous solution rat, human
western blot pricing
HPA014850 Anti-NEFL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
SAB1408610 Anti-NEFL antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
proximity ligation assay, western blot pricing
HPA015021 Anti-NEFL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB5300413 Monoclonal Anti-NEFL antibody produced in mouse clone 1H3, ascites fluid human
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB5300414 Monoclonal Anti-NEFL antibody produced in mouse clone 2G10, purified immunoglobulin, buffered aqueous solution human
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB4100574 Monoclonal Anti-NEFL antibody produced in mouse clone NEFL-A546, culture supernatant human
western blot pricing
AMAB91314 Monoclonal Anti-NEFL antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL4729, purified immunoglobulin human, mouse, rat
immunohistochemistry, western blot pricing
N5139 Monoclonal Anti-Neurofilament 68 antibody produced in mouse clone NR4, ascites fluid rat, pig, chicken, human
immunohistochemistry, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006158 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006158 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006158 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010910 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010910 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010910 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122701 MISSION® esiRNA esiRNA human NEFL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006158 Rosetta Predictions human pricing
NM_031783 Rosetta Predictions rat pricing
NM_010910 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006158 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042112 predicted 838
2 SASI_Hs01_00042113 predicted 1032
3 SASI_Hs01_00042115 predicted 734
4 SASI_Hs02_00341002 predicted 538
5 SASI_Hs01_00042117 predicted 610
6 SASI_Hs01_00042118 predicted 802
7 SASI_Hs02_00341003 predicted 1944
8 SASI_Hs01_00042121 predicted 1228
9 SASI_Hs01_00042120 predicted 324
10 SASI_Hs02_00341004 predicted 996
11 SASI_Hs01_00042114 predicted 730
12 SASI_Hs01_00042116 predicted 1161
13 SASI_Hs01_00042119 predicted 931
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031783 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051832 predicted 513
2 SASI_Rn01_00051833 predicted 986
3 SASI_Rn02_00265222 predicted 717
4 SASI_Rn01_00051835 predicted 1202
5 SASI_Rn01_00051836 predicted 1157
6 SASI_Rn01_00051837 predicted 1103
7 SASI_Rn01_00051839 predicted 702
8 SASI_Rn02_00265223 predicted 715
9 SASI_Rn01_00051841 predicted 770
10 SASI_Rn02_00265224 predicted 312
11 SASI_Rn01_00051834 predicted 1011
12 SASI_Rn01_00051838 predicted 306
13 SASI_Rn01_00051840 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010910 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020176 predicted 315
2 SASI_Mm01_00020178 predicted 1166
3 SASI_Mm01_00020179 predicted 585
4 SASI_Mm01_00020180 predicted 704
5 SASI_Mm01_00020181 predicted 1117
6 SASI_Mm01_00020182 predicted 303
7 SASI_Mm01_00020183 predicted 305
8 SASI_Mm01_00020184 predicted 520
9 SASI_Mm02_00319641 predicted 1013
10 SASI_Mm02_00319642 predicted 321
11 SASI_Mm01_00020177 predicted 1182
12 SASI_Mm01_00020185 predicted 1272
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006158
VALIDATED
NEFL MISSION shRNA Bacterial Glycerol Stock
neurofilament, light polypeptide
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006158.3-1234s21c1
Sequence:CCGGGTGAAGATGGCTTTGGATATTCTCGAGAATATCCAAAGCCATCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006158.3-1758s21c1
Sequence:CCGGAGGAATAATTCTCCCGAAATCCTCGAGGATTTCGGGAGAATTATTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006158.3-277s21c1
Sequence:CCGGTCCAGCTCTGGATCGTTGATGCTCGAGCATCAACGATCCAGAGCTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006158.3-2202s21c1
Sequence:CCGGCCTTAAAGATGGCACCAATATCTCGAGATATTGGTGCCATCTTTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006158.1-1321s1c1
Sequence:CCGGCCGTCCTACTACACCAGCCATCTCGAGATGGCTGGTGTAGTAGGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006158.1-101s1c1
Sequence:CCGGCCGCACGCTCAGCTTACTCAACTCGAGTTGAGTAAGCTGAGCGTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006158.1-1278s1c1
Sequence:CCGGCGGTTTACAGACCAGCTCCTACTCGAGTAGGAGCTGGTCTGTAAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006158.1-1045s1c1
Sequence:CCGGCAGGACACGATCAACAAATTACTCGAGTAATTTGTTGATCGTGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006158.1-642s1c1
Sequence:CCGGCGACAGCTTGATGGACGAAATCTCGAGATTTCGTCCATCAAGCTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006158
VALIDATED
NEFL MISSION shRNA shRNA Plasmid DNA
neurofilament, light polypeptide
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006158.3-1234s21c1
Sequence:CCGGGTGAAGATGGCTTTGGATATTCTCGAGAATATCCAAAGCCATCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006158.3-1758s21c1
Sequence:CCGGAGGAATAATTCTCCCGAAATCCTCGAGGATTTCGGGAGAATTATTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006158.3-277s21c1
Sequence:CCGGTCCAGCTCTGGATCGTTGATGCTCGAGCATCAACGATCCAGAGCTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006158.3-2202s21c1
Sequence:CCGGCCTTAAAGATGGCACCAATATCTCGAGATATTGGTGCCATCTTTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006158.1-1321s1c1
Sequence:CCGGCCGTCCTACTACACCAGCCATCTCGAGATGGCTGGTGTAGTAGGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006158.1-101s1c1
Sequence:CCGGCCGCACGCTCAGCTTACTCAACTCGAGTTGAGTAAGCTGAGCGTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006158.1-1278s1c1
Sequence:CCGGCGGTTTACAGACCAGCTCCTACTCGAGTAGGAGCTGGTCTGTAAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006158.1-1045s1c1
Sequence:CCGGCAGGACACGATCAACAAATTACTCGAGTAATTTGTTGATCGTGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006158.1-642s1c1
Sequence:CCGGCGACAGCTTGATGGACGAAATCTCGAGATTTCGTCCATCAAGCTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006158
VALIDATED
NEFL MISSION shRNA Lentiviral Transduction Particles
neurofilament, light polypeptide
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006158.3-1234s21c1
Sequence:CCGGGTGAAGATGGCTTTGGATATTCTCGAGAATATCCAAAGCCATCTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006158.3-1758s21c1
Sequence:CCGGAGGAATAATTCTCCCGAAATCCTCGAGGATTTCGGGAGAATTATTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006158.3-277s21c1
Sequence:CCGGTCCAGCTCTGGATCGTTGATGCTCGAGCATCAACGATCCAGAGCTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006158.3-2202s21c1
Sequence:CCGGCCTTAAAGATGGCACCAATATCTCGAGATATTGGTGCCATCTTTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006158.1-1321s1c1
Sequence:CCGGCCGTCCTACTACACCAGCCATCTCGAGATGGCTGGTGTAGTAGGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006158.1-101s1c1
Sequence:CCGGCCGCACGCTCAGCTTACTCAACTCGAGTTGAGTAAGCTGAGCGTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006158.1-1278s1c1
Sequence:CCGGCGGTTTACAGACCAGCTCCTACTCGAGTAGGAGCTGGTCTGTAAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006158.1-1045s1c1
Sequence:CCGGCAGGACACGATCAACAAATTACTCGAGTAATTTGTTGATCGTGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006158.1-642s1c1
Sequence:CCGGCGACAGCTTGATGGACGAAATCTCGAGATTTCGTCCATCAAGCTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010910
NEFL MISSION shRNA Bacterial Glycerol Stock
neurofilament, light polypeptide
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010910.1-1775s1c1
Sequence:CCGGCCAGTTGAGTTCCAGATCCTACTCGAGTAGGATCTGGAACTCAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010910.1-1448s1c1
Sequence:CCGGGAGACCATTGAGGCTACGAAACTCGAGTTTCGTAGCCTCAATGGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010910.1-326s1c1
Sequence:CCGGCTCAAGTCTATCCGCACACAACTCGAGTTGTGTGCGGATAGACTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010910.1-1378s1c1
Sequence:CCGGCTTGATGTCTGCTCGCTCTTTCTCGAGAAAGAGCGAGCAGACATCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010910.1-1342s1c1
Sequence:CCGGCCGTTCTGCTTACAGTGGCTTCTCGAGAAGCCACTGTAAGCAGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010910
NEFL MISSION shRNA shRNA Plasmid DNA
neurofilament, light polypeptide
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010910.1-1775s1c1
Sequence:CCGGCCAGTTGAGTTCCAGATCCTACTCGAGTAGGATCTGGAACTCAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010910.1-1448s1c1
Sequence:CCGGGAGACCATTGAGGCTACGAAACTCGAGTTTCGTAGCCTCAATGGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010910.1-326s1c1
Sequence:CCGGCTCAAGTCTATCCGCACACAACTCGAGTTGTGTGCGGATAGACTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010910.1-1378s1c1
Sequence:CCGGCTTGATGTCTGCTCGCTCTTTCTCGAGAAAGAGCGAGCAGACATCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010910.1-1342s1c1
Sequence:CCGGCCGTTCTGCTTACAGTGGCTTCTCGAGAAGCCACTGTAAGCAGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010910
NEFL MISSION shRNA Lentiviral Transduction Particles
neurofilament, light polypeptide
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010910.1-1775s1c1
Sequence:CCGGCCAGTTGAGTTCCAGATCCTACTCGAGTAGGATCTGGAACTCAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010910.1-1448s1c1
Sequence:CCGGGAGACCATTGAGGCTACGAAACTCGAGTTTCGTAGCCTCAATGGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010910.1-326s1c1
Sequence:CCGGCTCAAGTCTATCCGCACACAACTCGAGTTGTGTGCGGATAGACTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010910.1-1378s1c1
Sequence:CCGGCTTGATGTCTGCTCGCTCTTTCTCGAGAAAGAGCGAGCAGACATCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010910.1-1342s1c1
Sequence:CCGGCCGTTCTGCTTACAGTGGCTTCTCGAGAAGCCACTGTAAGCAGAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)