EMAIL THIS PAGE TO A FRIEND

NEGR1

neuronal growth regulator 1

204 Gene Product Result for
Synonyms: DMML2433 IGLON4 KILON Ntra
UniProtKB ID: Q7Z3B1, Q5VT21, Q6UY06, Q8NAQ3
Gene ID:
Mouse(320840) neuronal growth regulator 1
Rat(59318) neuronal growth regulator 1
Zebrafish(445374) neuronal growth regulator 1
cow(781106) neuronal growth regulator 1
Horse(100053464) neuronal growth regulator 1
chicken(395662) neuronal growth regulator 1
domestic cat(101084810) neuronal growth regulator 1
dog(612706) neuronal growth regulator 1
naked mole-rat(101715167) neuronal growth regulator 1
domestic guinea pig(100717052) neuronal growth regulator 1
sheep(101119516) neuronal growth regulator 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173808 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173808 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173808 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177274 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177274 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177274 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173808 Rosetta Predictions human pricing
NM_021682 Rosetta Predictions rat pricing
NM_001039094 Rosetta Predictions mouse pricing
NM_177274 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173808 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368666 predicted 1114
2 SASI_Hs01_00235047 predicted 1245
3 SASI_Hs01_00235048 predicted 530
4 SASI_Hs01_00235049 predicted 488
5 SASI_Hs01_00235050 predicted 717
6 SASI_Hs01_00235051 predicted 757
7 SASI_Hs01_00235052 predicted 501
8 SASI_Hs01_00235054 predicted 1213
9 SASI_Hs01_00235055 predicted 759
10 SASI_Hs02_00368667 predicted 589
11 SASI_Hs01_00235046 predicted 669
12 SASI_Hs01_00235053 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021682 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058969 predicted 621
2 SASI_Rn01_00058970 predicted 238
3 SASI_Rn01_00058971 predicted 1200
4 SASI_Rn01_00058972 predicted 386
5 SASI_Rn01_00058973 predicted 568
6 SASI_Rn01_00058974 predicted 688
7 SASI_Rn01_00058975 predicted 1080
8 SASI_Rn01_00058976 predicted 741
9 SASI_Rn02_00262708 predicted 248
10 SASI_Rn01_00058977 predicted 1115
11 SASI_Rn01_00058978 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039094 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184413 predicted 590
2 SASI_Mm01_00184414 predicted 834
3 SASI_Mm01_00184415 predicted 982
4 SASI_Mm02_00289781 predicted 557
5 SASI_Mm01_00184416 predicted 999
6 SASI_Mm01_00184417 predicted 883
7 SASI_Mm01_00184418 predicted 1056
8 SASI_Mm01_00184419 predicted 1033
9 SASI_Mm01_00184420 predicted 692
10 SASI_Mm01_00184421 predicted 777
11 SASI_Mm01_00184422 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177274 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088561 predicted 422
2 SASI_Mm01_00088562 predicted 670
3 SASI_Mm01_00088563 predicted 810
4 SASI_Mm02_00347323 predicted 483
5 SASI_Mm02_00347324 predicted 398
6 SASI_Mm01_00088564 predicted 833
7 SASI_Mm01_00088565 predicted 716
8 SASI_Mm01_00088566 predicted 891
9 SASI_Mm01_00088567 predicted 872
10 SASI_Mm01_00088568 predicted 532
11 SASI_Mm01_00088569 predicted 617
12 SASI_Mm01_00088570 predicted 418
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173808
NEGR1 MISSION shRNA Bacterial Glycerol Stock
neuronal growth regulator 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173808.2-265s21c1
Sequence:CCGGGGCGGTGCTTAGGTGTTATTTCTCGAGAAATAACACCTAAGCACCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173808.2-761s21c1
Sequence:CCGGGTCAACTTTGCTCCTACTATTCTCGAGAATAGTAGGAGCAAAGTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173808.2-312s21c1
Sequence:CCGGGGCTGAACCGGTCAAGTATTACTCGAGTAATACTTGACCGGTTCAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173808.2-966s21c1
Sequence:CCGGAGGAGCACTTCGGCAATTATACTCGAGTATAATTGCCGAAGTGCTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173808.1-372s1c1
Sequence:CCGGCTCAACATACACCCAGAACAACTCGAGTTGTTCTGGGTGTATGTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173808.1-439s1c1
Sequence:CCGGCTCAAATGATATGACCGTCAACTCGAGTTGACGGTCATATCATTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173808.1-840s1c1
Sequence:CCGGCAAGATCCATTCTCACTGTTACTCGAGTAACAGTGAGAATGGATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173808.1-186s1c1
Sequence:CCGGGTTATTTGGAAGATGGAGCTTCTCGAGAAGCTCCATCTTCCAAATAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173808.1-1035s1c1
Sequence:CCGGCCAGCATATTCTACCTGAAGACTCGAGTCTTCAGGTAGAATATGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173808.1-468s1c1
Sequence:CCGGCCAACGTCACTCTTACTTGTTCTCGAGAACAAGTAAGAGTGACGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173808.1-764s1c1
Sequence:CCGGCCAGCCTTTGAATGGTACAAACTCGAGTTTGTACCATTCAAAGGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173808
NEGR1 MISSION shRNA shRNA Plasmid DNA
neuronal growth regulator 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173808.2-265s21c1
Sequence:CCGGGGCGGTGCTTAGGTGTTATTTCTCGAGAAATAACACCTAAGCACCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173808.2-761s21c1
Sequence:CCGGGTCAACTTTGCTCCTACTATTCTCGAGAATAGTAGGAGCAAAGTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173808.2-312s21c1
Sequence:CCGGGGCTGAACCGGTCAAGTATTACTCGAGTAATACTTGACCGGTTCAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173808.2-966s21c1
Sequence:CCGGAGGAGCACTTCGGCAATTATACTCGAGTATAATTGCCGAAGTGCTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173808.1-372s1c1
Sequence:CCGGCTCAACATACACCCAGAACAACTCGAGTTGTTCTGGGTGTATGTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173808.1-439s1c1
Sequence:CCGGCTCAAATGATATGACCGTCAACTCGAGTTGACGGTCATATCATTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173808.1-840s1c1
Sequence:CCGGCAAGATCCATTCTCACTGTTACTCGAGTAACAGTGAGAATGGATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173808.1-186s1c1
Sequence:CCGGGTTATTTGGAAGATGGAGCTTCTCGAGAAGCTCCATCTTCCAAATAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173808.1-1035s1c1
Sequence:CCGGCCAGCATATTCTACCTGAAGACTCGAGTCTTCAGGTAGAATATGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173808.1-468s1c1
Sequence:CCGGCCAACGTCACTCTTACTTGTTCTCGAGAACAAGTAAGAGTGACGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173808.1-764s1c1
Sequence:CCGGCCAGCCTTTGAATGGTACAAACTCGAGTTTGTACCATTCAAAGGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173808
NEGR1 MISSION shRNA Lentiviral Transduction Particles
neuronal growth regulator 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173808.2-265s21c1
Sequence:CCGGGGCGGTGCTTAGGTGTTATTTCTCGAGAAATAACACCTAAGCACCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173808.2-761s21c1
Sequence:CCGGGTCAACTTTGCTCCTACTATTCTCGAGAATAGTAGGAGCAAAGTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173808.2-312s21c1
Sequence:CCGGGGCTGAACCGGTCAAGTATTACTCGAGTAATACTTGACCGGTTCAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173808.2-966s21c1
Sequence:CCGGAGGAGCACTTCGGCAATTATACTCGAGTATAATTGCCGAAGTGCTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173808.1-372s1c1
Sequence:CCGGCTCAACATACACCCAGAACAACTCGAGTTGTTCTGGGTGTATGTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173808.1-439s1c1
Sequence:CCGGCTCAAATGATATGACCGTCAACTCGAGTTGACGGTCATATCATTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173808.1-840s1c1
Sequence:CCGGCAAGATCCATTCTCACTGTTACTCGAGTAACAGTGAGAATGGATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173808.1-186s1c1
Sequence:CCGGGTTATTTGGAAGATGGAGCTTCTCGAGAAGCTCCATCTTCCAAATAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173808.1-1035s1c1
Sequence:CCGGCCAGCATATTCTACCTGAAGACTCGAGTCTTCAGGTAGAATATGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173808.1-468s1c1
Sequence:CCGGCCAACGTCACTCTTACTTGTTCTCGAGAACAAGTAAGAGTGACGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173808.1-764s1c1
Sequence:CCGGCCAGCCTTTGAATGGTACAAACTCGAGTTTGTACCATTCAAAGGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177274
NEGR1 MISSION shRNA Bacterial Glycerol Stock
neuronal growth regulator 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177274.2-1634s1c1
Sequence:CCGGCCAGCCATATAAGTAATCAAACTCGAGTTTGATTACTTATATGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177274.2-889s1c1
Sequence:CCGGGCGCCTACAATTCAGGAAATTCTCGAGAATTTCCTGAATTGTAGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177274.2-432s1c1
Sequence:CCGGGCTCAACAGGTCAAGTATCATCTCGAGATGATACTTGACCTGTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177274.2-984s1c1
Sequence:CCGGCGAGTGGTACAAAGGAGAGAACTCGAGTTCTCTCCTTTGTACCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177274.2-890s1c1
Sequence:CCGGCGCCTACAATTCAGGAAATTACTCGAGTAATTTCCTGAATTGTAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177274
NEGR1 MISSION shRNA shRNA Plasmid DNA
neuronal growth regulator 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177274.2-1634s1c1
Sequence:CCGGCCAGCCATATAAGTAATCAAACTCGAGTTTGATTACTTATATGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177274.2-889s1c1
Sequence:CCGGGCGCCTACAATTCAGGAAATTCTCGAGAATTTCCTGAATTGTAGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177274.2-432s1c1
Sequence:CCGGGCTCAACAGGTCAAGTATCATCTCGAGATGATACTTGACCTGTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177274.2-984s1c1
Sequence:CCGGCGAGTGGTACAAAGGAGAGAACTCGAGTTCTCTCCTTTGTACCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177274.2-890s1c1
Sequence:CCGGCGCCTACAATTCAGGAAATTACTCGAGTAATTTCCTGAATTGTAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177274
NEGR1 MISSION shRNA Lentiviral Transduction Particles
neuronal growth regulator 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177274.2-1634s1c1
Sequence:CCGGCCAGCCATATAAGTAATCAAACTCGAGTTTGATTACTTATATGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177274.2-889s1c1
Sequence:CCGGGCGCCTACAATTCAGGAAATTCTCGAGAATTTCCTGAATTGTAGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177274.2-432s1c1
Sequence:CCGGGCTCAACAGGTCAAGTATCATCTCGAGATGATACTTGACCTGTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177274.2-984s1c1
Sequence:CCGGCGAGTGGTACAAAGGAGAGAACTCGAGTTCTCTCCTTTGTACCACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177274.2-890s1c1
Sequence:CCGGCGCCTACAATTCAGGAAATTACTCGAGTAATTTCCTGAATTGTAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)