EMAIL THIS PAGE TO A FRIEND

NEIL3

nei endonuclease VIII-like 3 (E. coli)

54 Gene Product Result for
Synonyms: FGP2 FPG2 NEI3 hFPG2 hNEI3
UniProtKB ID: Q8TAT5, Q2PPJ3, Q8NG51, Q9NV95
Gene ID:
Human(55247) Summary: NEIL3 belongs to a class of DNA glycosylases homologous to the bacterial Fpg/Nei family. These glycosylases initiate the first step in base excision repair by cleaving bases damaged by reactive oxygen species and introducing a DNA strand break via the associated lyase reaction (Bandaru et al., 2002 [PubMed 12509226]
Mouse(234258) nei like 3 (E. coli)
Rat(290729) nei endonuclease VIII-like 3 (E. coli)
Zebrafish(492463) nei endonuclease VIII-like 3 (E. coli)
dog(475639) nei endonuclease VIII-like 3 (E. coli)
cow(515343) nei endonuclease VIII-like 3 (E. coli)
Horse(100060702) nei endonuclease VIII-like 3 (E. coli)
domestic cat(101085881) nei endonuclease VIII-like 3 (E. coli)
chicken(428750) nei endonuclease VIII-like 3 (E. coli)
sheep(101106140) nei endonuclease VIII-like 3 (E. coli)
domestic guinea pig(100723918) nei endonuclease VIII-like 3 (E. coli)
naked mole-rat(101721261) nei endonuclease VIII-like 3 (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018248 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018248 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018248 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146208 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146208 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146208 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018248 Rosetta Predictions human pricing
XM_001057215 Rosetta Predictions rat pricing
XM_224835 Rosetta Predictions rat pricing
NM_146208 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018248 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041467 predicted 735
2 SASI_Hs02_00351598 predicted 1435
3 SASI_Hs01_00041470 predicted 1203
4 SASI_Hs01_00041471 predicted 1184
5 SASI_Hs01_00041472 predicted 398
6 SASI_Hs02_00351599 predicted 1529
7 SASI_Hs02_00351600 predicted 291
8 SASI_Hs01_00041473 predicted 648
9 SASI_Hs01_00041474 predicted 1556
10 SASI_Hs01_00041475 predicted 1752
11 SASI_Hs01_00041468 predicted 1495
12 SASI_Hs01_00041469 predicted 817
13 SASI_Hs01_00041476 predicted 1205
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057215 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285754 predicted 1433
2 SASI_Rn02_00285755 predicted 968
3 SASI_Rn02_00285756 predicted 1472
4 SASI_Rn02_00285757 predicted 1169
5 SASI_Rn02_00285758 predicted 400
6 SASI_Rn02_00285759 predicted 729
7 SASI_Rn02_00285760 predicted 1082
8 SASI_Rn02_00285761 predicted 1413
9 SASI_Rn02_00285762 predicted 852
10 SASI_Rn02_00285763 predicted 1461
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224835 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382296 predicted 1434
2 SASI_Rn02_00382297 predicted 966
3 SASI_Rn02_00382298 predicted 1473
4 SASI_Rn02_00382299 predicted 1164
5 SASI_Rn02_00382300 predicted 395
6 SASI_Rn02_00382301 predicted 733
7 SASI_Rn02_00382302 predicted 1079
8 SASI_Rn02_00382303 predicted 1412
9 SASI_Rn02_00382304 predicted 845
10 SASI_Rn02_00382305 predicted 1465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146208 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104209 predicted 487
2 SASI_Mm01_00104210 predicted 691
3 SASI_Mm01_00104211 predicted 1186
4 SASI_Mm01_00104212 predicted 1463
5 SASI_Mm01_00104213 predicted 852
6 SASI_Mm01_00104214 predicted 718
7 SASI_Mm01_00104215 predicted 1316
8 SASI_Mm01_00104216 predicted 1455
9 SASI_Mm02_00341910 predicted 787
10 SASI_Mm01_00104218 predicted 558
11 SASI_Mm01_00104217 predicted 1228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018248
NEIL3 MISSION shRNA Bacterial Glycerol Stock
nei endonuclease VIII-like 3 (E. coli)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018248.2-1185s21c1
Sequence:CCGGTACTGTCTTTAGCCACTTAATCTCGAGATTAAGTGGCTAAAGACAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018248.2-1418s21c1
Sequence:CCGGAGAAGACAACAAACGATATAACTCGAGTTATATCGTTTGTTGTCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018248.2-657s21c1
Sequence:CCGGGCTAATGGATCAGAACGTATTCTCGAGAATACGTTCTGATCCATTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007907    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018248.1-2109s1c1
Sequence:CCGGCGGATATACAGCATATTCCATCTCGAGATGGAATATGCTGTATATCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018248.1-953s1c1
Sequence:CCGGGCTACCGACTAGAAATACTATCTCGAGATAGTATTTCTAGTCGGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018248.1-1524s1c1
Sequence:CCGGCCTGGATATTCTAACAGTGAACTCGAGTTCACTGTTAGAATATCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018248.1-357s1c1
Sequence:CCGGCGGATTCATTTCGGAATGAAACTCGAGTTTCATTCCGAAATGAATCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018248.1-277s1c1
Sequence:CCGGGCCTGTTTAATGGATATGTTTCTCGAGAAACATATCCATTAAACAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018248.2-2185s21c1
Sequence:CCGGGCATTTAGTAATGACGATAAACTCGAGTTTATCGTCATTACTAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018248
NEIL3 MISSION shRNA shRNA Plasmid DNA
nei endonuclease VIII-like 3 (E. coli)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018248.2-1185s21c1
Sequence:CCGGTACTGTCTTTAGCCACTTAATCTCGAGATTAAGTGGCTAAAGACAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018248.2-1418s21c1
Sequence:CCGGAGAAGACAACAAACGATATAACTCGAGTTATATCGTTTGTTGTCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018248.2-657s21c1
Sequence:CCGGGCTAATGGATCAGAACGTATTCTCGAGAATACGTTCTGATCCATTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007907    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018248.1-2109s1c1
Sequence:CCGGCGGATATACAGCATATTCCATCTCGAGATGGAATATGCTGTATATCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018248.1-953s1c1
Sequence:CCGGGCTACCGACTAGAAATACTATCTCGAGATAGTATTTCTAGTCGGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018248.1-1524s1c1
Sequence:CCGGCCTGGATATTCTAACAGTGAACTCGAGTTCACTGTTAGAATATCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018248.1-357s1c1
Sequence:CCGGCGGATTCATTTCGGAATGAAACTCGAGTTTCATTCCGAAATGAATCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018248.1-277s1c1
Sequence:CCGGGCCTGTTTAATGGATATGTTTCTCGAGAAACATATCCATTAAACAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018248.2-2185s21c1
Sequence:CCGGGCATTTAGTAATGACGATAAACTCGAGTTTATCGTCATTACTAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018248
NEIL3 MISSION shRNA Lentiviral Transduction Particles
nei endonuclease VIII-like 3 (E. coli)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018248.2-1185s21c1
Sequence:CCGGTACTGTCTTTAGCCACTTAATCTCGAGATTAAGTGGCTAAAGACAGTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018248.2-1418s21c1
Sequence:CCGGAGAAGACAACAAACGATATAACTCGAGTTATATCGTTTGTTGTCTTCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018248.2-657s21c1
Sequence:CCGGGCTAATGGATCAGAACGTATTCTCGAGAATACGTTCTGATCCATTAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007907    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018248.1-2109s1c1
Sequence:CCGGCGGATATACAGCATATTCCATCTCGAGATGGAATATGCTGTATATCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018248.1-953s1c1
Sequence:CCGGGCTACCGACTAGAAATACTATCTCGAGATAGTATTTCTAGTCGGTAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018248.1-1524s1c1
Sequence:CCGGCCTGGATATTCTAACAGTGAACTCGAGTTCACTGTTAGAATATCCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018248.1-357s1c1
Sequence:CCGGCGGATTCATTTCGGAATGAAACTCGAGTTTCATTCCGAAATGAATCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018248.1-277s1c1
Sequence:CCGGGCCTGTTTAATGGATATGTTTCTCGAGAAACATATCCATTAAACAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018248.2-2185s21c1
Sequence:CCGGGCATTTAGTAATGACGATAAACTCGAGTTTATCGTCATTACTAAATGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146208
VALIDATED
NEIL3 MISSION shRNA Bacterial Glycerol Stock
nei endonuclease VIII-like 3 (E. coli)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146208.1-692s21c1
Sequence:CCGGGCACTCTTTGACAGTGGTCTTCTCGAGAAGACCACTGTCAAAGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146208.1-1795s21c1
Sequence:CCGGGCTGAAGATTGGACCTAATAACTCGAGTTATTAGGTCCAATCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146208.1-775s21c1
Sequence:CCGGTCGGGATTTCAGCATTCTCTTCTCGAGAAGAGAATGCTGAAATCCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146208.1-292s21c1
Sequence:CCGGCTTGAGACTGTTTAATGGATACTCGAGTATCCATTAAACAGTCTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146208.1-1942s1c1
Sequence:CCGGCCCGTCTCATAAACTCATCAACTCGAGTTGATGAGTTTATGAGACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146208.1-292s1c1
Sequence:CCGGCTTGAGACTGTTTAATGGATACTCGAGTATCCATTAAACAGTCTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146208.1-692s1c1
Sequence:CCGGGCACTCTTTGACAGTGGTCTTCTCGAGAAGACCACTGTCAAAGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146208.1-1795s1c1
Sequence:CCGGGCTGAAGATTGGACCTAATAACTCGAGTTATTAGGTCCAATCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146208.1-775s1c1
Sequence:CCGGTCGGGATTTCAGCATTCTCTTCTCGAGAAGAGAATGCTGAAATCCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146208.1-1942s21c1
Sequence:CCGGCCCGTCTCATAAACTCATCAACTCGAGTTGATGAGTTTATGAGACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146208
VALIDATED
NEIL3 MISSION shRNA shRNA Plasmid DNA
nei endonuclease VIII-like 3 (E. coli)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146208.1-692s21c1
Sequence:CCGGGCACTCTTTGACAGTGGTCTTCTCGAGAAGACCACTGTCAAAGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146208.1-1795s21c1
Sequence:CCGGGCTGAAGATTGGACCTAATAACTCGAGTTATTAGGTCCAATCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146208.1-775s21c1
Sequence:CCGGTCGGGATTTCAGCATTCTCTTCTCGAGAAGAGAATGCTGAAATCCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146208.1-292s21c1
Sequence:CCGGCTTGAGACTGTTTAATGGATACTCGAGTATCCATTAAACAGTCTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146208.1-1942s1c1
Sequence:CCGGCCCGTCTCATAAACTCATCAACTCGAGTTGATGAGTTTATGAGACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146208.1-292s1c1
Sequence:CCGGCTTGAGACTGTTTAATGGATACTCGAGTATCCATTAAACAGTCTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146208.1-692s1c1
Sequence:CCGGGCACTCTTTGACAGTGGTCTTCTCGAGAAGACCACTGTCAAAGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146208.1-1795s1c1
Sequence:CCGGGCTGAAGATTGGACCTAATAACTCGAGTTATTAGGTCCAATCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146208.1-775s1c1
Sequence:CCGGTCGGGATTTCAGCATTCTCTTCTCGAGAAGAGAATGCTGAAATCCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146208.1-1942s21c1
Sequence:CCGGCCCGTCTCATAAACTCATCAACTCGAGTTGATGAGTTTATGAGACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146208
VALIDATED
NEIL3 MISSION shRNA Lentiviral Transduction Particles
nei endonuclease VIII-like 3 (E. coli)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146208.1-692s21c1
Sequence:CCGGGCACTCTTTGACAGTGGTCTTCTCGAGAAGACCACTGTCAAAGAGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146208.1-1795s21c1
Sequence:CCGGGCTGAAGATTGGACCTAATAACTCGAGTTATTAGGTCCAATCTTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146208.1-775s21c1
Sequence:CCGGTCGGGATTTCAGCATTCTCTTCTCGAGAAGAGAATGCTGAAATCCCGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146208.1-292s21c1
Sequence:CCGGCTTGAGACTGTTTAATGGATACTCGAGTATCCATTAAACAGTCTCAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146208.1-1942s1c1
Sequence:CCGGCCCGTCTCATAAACTCATCAACTCGAGTTGATGAGTTTATGAGACGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146208.1-292s1c1
Sequence:CCGGCTTGAGACTGTTTAATGGATACTCGAGTATCCATTAAACAGTCTCAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146208.1-692s1c1
Sequence:CCGGGCACTCTTTGACAGTGGTCTTCTCGAGAAGACCACTGTCAAAGAGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146208.1-1795s1c1
Sequence:CCGGGCTGAAGATTGGACCTAATAACTCGAGTTATTAGGTCCAATCTTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146208.1-775s1c1
Sequence:CCGGTCGGGATTTCAGCATTCTCTTCTCGAGAAGAGAATGCTGAAATCCCGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146208.1-1942s21c1
Sequence:CCGGCCCGTCTCATAAACTCATCAACTCGAGTTGATGAGTTTATGAGACGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)