EMAIL THIS PAGE TO A FRIEND

NEK10

NIMA-related kinase 10

110 Gene Product Result for
Gene ID:
Mouse(674895) NIMA (never in mitosis gene a)- related kinase 10
Rat(305710) NIMA-related kinase 10
sheep(101108783) NIMA-related kinase 10
domestic guinea pig(100714272) NIMA-related kinase 10
Domestic Rabbit(100340252) NIMA (never in mitosis gene a)- related kinase 10
naked mole-rat(101698412) NIMA-related kinase 10
Zebrafish(100333839) NIMA (never in mitosis gene a)- related kinase 10
domestic cat(101087091) NIMA (never in mitosis gene a)- related kinase 10
dog(485638) NIMA (never in mitosis gene a)- related kinase 10
chicken(776071) NIMA (never in mitosis gene a)- related kinase 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152534 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152534 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152534 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031741 Rosetta Predictions human pricing
NM_152534 Rosetta Predictions human pricing
XM_223815 Rosetta Predictions rat pricing
XR_008558 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031741 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240516 predicted 618
2 SASI_Hs01_00240517 predicted 655
3 SASI_Hs01_00240519 predicted 622
4 SASI_Hs01_00240520 predicted 667
5 SASI_Hs01_00240521 predicted 626
6 SASI_Hs02_00307804 predicted 637
7 SASI_Hs01_00240522 predicted 621
8 SASI_Hs01_00240523 predicted 684
9 SASI_Hs01_00240524 predicted 661
10 SASI_Hs01_00240525 predicted 616
11 SASI_Hs01_00240518 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152534 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203614 predicted 851
2 SASI_Hs01_00203615 predicted 885
3 SASI_Hs01_00203617 predicted 847
4 SASI_Hs01_00203618 predicted 895
5 SASI_Hs01_00203619 predicted 861
6 SASI_Hs02_00366334 predicted 869
7 SASI_Hs01_00203620 predicted 851
8 SASI_Hs01_00203621 predicted 908
9 SASI_Hs01_00203622 predicted 893
10 SASI_Hs01_00203623 predicted 846
11 SASI_Hs01_00203616 predicted 867
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223815 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00130118 predicted 585
2 SASI_Rn01_00130119 predicted 1230
3 SASI_Rn01_00130120 predicted 1013
4 SASI_Rn01_00130121 predicted 1936
5 SASI_Rn01_00130122 predicted 1587
6 SASI_Rn01_00130123 predicted 701
7 SASI_Rn01_00130124 predicted 1726
8 SASI_Rn01_00130125 predicted 1150
9 SASI_Rn01_00130126 predicted 1673
10 SASI_Rn01_00130127 predicted 672
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008558 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00161310 predicted 535
2 SASI_Rn01_00161311 predicted 1180
3 SASI_Rn02_00417330 predicted 2223
4 SASI_Rn01_00161313 predicted 1883
5 SASI_Rn01_00161314 predicted 1534
6 SASI_Rn02_00417331 predicted 2526
7 SASI_Rn01_00161317 predicted 1096
8 SASI_Rn01_00161319 predicted 622
9 SASI_Rn02_00417332 predicted 216
10 SASI_Rn02_00417333 predicted 493
11 SASI_Rn01_00161312 predicted 960
12 SASI_Rn01_00161315 predicted 655
13 SASI_Rn01_00161316 predicted 1678
14 SASI_Rn01_00161318 predicted 1623
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152534
NEK10 MISSION shRNA Bacterial Glycerol Stock
NIMA-related kinase 10
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152534.2-312s1c1
Sequence:CCGGGCTTAGCTCTTCGATACTTACCTCGAGGTAAGTATCGAAGAGCTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152534.2-1109s1c1
Sequence:CCGGGAATTGGACATTTCGGATAACCTCGAGGTTATCCGAAATGTCCAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152534.2-578s1c1
Sequence:CCGGCCCTTCTACAGCACTAACATGCTCGAGCATGTTAGTGCTGTAGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194780    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152534.2-1423s1c1
Sequence:CCGGCACATTGATGTTAAGCACACACTCGAGTGTGTGCTTAACATCAATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152534.2-551s1c1
Sequence:CCGGCTTTATCAGATGGCGACTTTGCTCGAGCAAAGTCGCCATCTGATAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152534.2-362s1c1
Sequence:CCGGCTGACACCAAACAACATTATGCTCGAGCATAATGTTGTTTGGTGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152534.2-1376s1c1
Sequence:CCGGGCTGTGATTCTTCGAAATCTCCTCGAGGAGATTTCGAAGAATCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152534.x-1459s1c1
Sequence:CCGGCACAGCAGATTACCATTTATTCTCGAGAATAAATGGTAATCTGCTGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152534.x-479s1c1
Sequence:CCGGGCTCGTCCAGATATTGTAGAACTCGAGTTCTACAATATCTGGACGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152534.x-1378s1c1
Sequence:CCGGGCAGAGTAACCCTTGTAATTTCTCGAGAAATTACAAGGGTTACTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152534.x-1043s1c1
Sequence:CCGGCCTCTTGACCTGCTTCTGAAACTCGAGTTTCAGAAGCAGGTCAAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152534
NEK10 MISSION shRNA shRNA Plasmid DNA
NIMA-related kinase 10
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152534.2-312s1c1
Sequence:CCGGGCTTAGCTCTTCGATACTTACCTCGAGGTAAGTATCGAAGAGCTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152534.2-1109s1c1
Sequence:CCGGGAATTGGACATTTCGGATAACCTCGAGGTTATCCGAAATGTCCAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152534.2-578s1c1
Sequence:CCGGCCCTTCTACAGCACTAACATGCTCGAGCATGTTAGTGCTGTAGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194780    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152534.2-1423s1c1
Sequence:CCGGCACATTGATGTTAAGCACACACTCGAGTGTGTGCTTAACATCAATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152534.2-551s1c1
Sequence:CCGGCTTTATCAGATGGCGACTTTGCTCGAGCAAAGTCGCCATCTGATAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152534.2-362s1c1
Sequence:CCGGCTGACACCAAACAACATTATGCTCGAGCATAATGTTGTTTGGTGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152534.2-1376s1c1
Sequence:CCGGGCTGTGATTCTTCGAAATCTCCTCGAGGAGATTTCGAAGAATCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152534.x-1459s1c1
Sequence:CCGGCACAGCAGATTACCATTTATTCTCGAGAATAAATGGTAATCTGCTGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152534.x-479s1c1
Sequence:CCGGGCTCGTCCAGATATTGTAGAACTCGAGTTCTACAATATCTGGACGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152534.x-1378s1c1
Sequence:CCGGGCAGAGTAACCCTTGTAATTTCTCGAGAAATTACAAGGGTTACTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152534.x-1043s1c1
Sequence:CCGGCCTCTTGACCTGCTTCTGAAACTCGAGTTTCAGAAGCAGGTCAAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152534
NEK10 MISSION shRNA Lentiviral Transduction Particles
NIMA-related kinase 10
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152534.2-312s1c1
Sequence:CCGGGCTTAGCTCTTCGATACTTACCTCGAGGTAAGTATCGAAGAGCTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152534.2-1109s1c1
Sequence:CCGGGAATTGGACATTTCGGATAACCTCGAGGTTATCCGAAATGTCCAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152534.2-578s1c1
Sequence:CCGGCCCTTCTACAGCACTAACATGCTCGAGCATGTTAGTGCTGTAGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194780    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152534.2-1423s1c1
Sequence:CCGGCACATTGATGTTAAGCACACACTCGAGTGTGTGCTTAACATCAATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152534.2-551s1c1
Sequence:CCGGCTTTATCAGATGGCGACTTTGCTCGAGCAAAGTCGCCATCTGATAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152534.2-362s1c1
Sequence:CCGGCTGACACCAAACAACATTATGCTCGAGCATAATGTTGTTTGGTGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152534.2-1376s1c1
Sequence:CCGGGCTGTGATTCTTCGAAATCTCCTCGAGGAGATTTCGAAGAATCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152534.x-1459s1c1
Sequence:CCGGCACAGCAGATTACCATTTATTCTCGAGAATAAATGGTAATCTGCTGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152534.x-479s1c1
Sequence:CCGGGCTCGTCCAGATATTGTAGAACTCGAGTTCTACAATATCTGGACGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152534.x-1378s1c1
Sequence:CCGGGCAGAGTAACCCTTGTAATTTCTCGAGAAATTACAAGGGTTACTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152534.x-1043s1c1
Sequence:CCGGCCTCTTGACCTGCTTCTGAAACTCGAGTTTCAGAAGCAGGTCAAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)