EMAIL THIS PAGE TO A FRIEND

NEK11

NIMA-related kinase 11

89 Gene Product Result for
UniProtKB ID: Q8NG66, A6NHD7, Q5JPC0, Q8NG65, Q8TBY1, Q9H5F4
Gene ID:
Human(79858) Summary: This gene encodes a member of the never in mitosis gene A family of kinases. The encoded protein localizes to the nucleoli, and may function with NEK2A in the S-phase checkpoint. The encoded protein appears to play roles in DNA replication and response to genotoxic stress. Alternatively spliced transcript variants have been described.[provided by RefSeq, Mar 2009]
Mouse(208583) NIMA (never in mitosis gene a)-related expressed kinase 11
Rat(315978) NIMA-related kinase 11
chicken(100857506) NIMA (never in mitosis gene a)- related kinase 11
Horse(100064611) NIMA (never in mitosis gene a)- related kinase 11
cow(614924) NIMA-related kinase 11
domestic cat(101095192) NIMA (never in mitosis gene a)- related kinase 11
dog(485660) NIMA (never in mitosis gene a)- related kinase 11
naked mole-rat(101708450) NIMA-related kinase 11
domestic guinea pig(100718145) NIMA-related kinase 11
sheep(101121391) NIMA-related kinase 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024800 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024800 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024800 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172461 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172461 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172461 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU073631 MISSION® esiRNA esiRNA human NEK11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024800 Rosetta Predictions human pricing
NM_145910 Rosetta Predictions human pricing
NM_001108182 Rosetta Predictions rat pricing
NM_172461 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024800 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010651 predicted 892
2 SASI_Hs01_00010652 predicted 1093
3 SASI_Hs01_00010653 predicted 445
4 SASI_Hs01_00010654 predicted 457
5 SASI_Hs01_00010655 predicted 1420
6 SASI_Hs01_00010656 predicted 1228
7 SASI_Hs01_00010657 predicted 1449
8 SASI_Hs01_00010658 predicted 502
9 SASI_Hs01_00010659 predicted 1165
10 SASI_Hs01_00010660 predicted 1157
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046578 predicted 897
2 SASI_Hs01_00046579 predicted 1095
3 SASI_Hs01_00046580 predicted 443
4 SASI_Hs01_00046581 predicted 464
5 SASI_Hs01_00046582 predicted 1416
6 SASI_Hs01_00046583 predicted 1228
7 SASI_Hs01_00046584 predicted 1447
8 SASI_Hs01_00046585 predicted 504
9 SASI_Hs01_00046586 predicted 1167
10 SASI_Hs01_00046587 predicted 1160
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108182 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236144 predicted 1024
2 SASI_Rn02_00236145 predicted 648
3 SASI_Rn02_00236146 predicted 1256
4 SASI_Rn02_00236147 predicted 581
5 SASI_Rn02_00236148 predicted 1633
6 SASI_Rn02_00236149 predicted 982
7 SASI_Rn02_00236150 predicted 575
8 SASI_Rn02_00236151 predicted 889
9 SASI_Rn02_00236152 predicted 1199
10 SASI_Rn02_00236153 predicted 1081
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172461 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035875 predicted 266
2 SASI_Mm01_00035876 predicted 531
3 SASI_Mm01_00035877 predicted 881
4 SASI_Mm01_00035879 predicted 588
5 SASI_Mm02_00343995 predicted 1702
6 SASI_Mm01_00035880 predicted 1682
7 SASI_Mm01_00035881 predicted 1826
8 SASI_Mm01_00035882 predicted 1690
9 SASI_Mm01_00035883 predicted 970
10 SASI_Mm01_00035884 predicted 530
11 SASI_Mm01_00035878 predicted 2048
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024800
NEK11 MISSION shRNA Bacterial Glycerol Stock
NIMA-related kinase 11
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024800.x-445s1c1
Sequence:CCGGCCAAACGAGGAGAGGAATTAACTCGAGTTAATTCCTCTCCTCGTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024800.x-1797s1c1
Sequence:CCGGCCAGAGAAAGAAATCAGGAATCTCGAGATTCCTGATTTCTTTCTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024800.x-1785s1c1
Sequence:CCGGGCGTTAGAAAGACCAGAGAAACTCGAGTTTCTCTGGTCTTTCTAACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024800.x-2736s1c1
Sequence:CCGGCCATGACTAATAAGGAAGATACTCGAGTATCTTCCTTATTAGTCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024800.x-1146s1c1
Sequence:CCGGCCTTACCTTGATGAGCAGCTACTCGAGTAGCTGCTCATCAAGGTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024800.2-1169s1c1
Sequence:CCGGGAACCTAATGTGTAGATATTCCTCGAGGAATATCTACACATTAGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024800.2-486s1c1
Sequence:CCGGGTTGGAGAACTAAATCCAAATCTCGAGATTTGGATTTAGTTCTCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024800
NEK11 MISSION shRNA shRNA Plasmid DNA
NIMA-related kinase 11
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024800.x-445s1c1
Sequence:CCGGCCAAACGAGGAGAGGAATTAACTCGAGTTAATTCCTCTCCTCGTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024800.x-1797s1c1
Sequence:CCGGCCAGAGAAAGAAATCAGGAATCTCGAGATTCCTGATTTCTTTCTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024800.x-1785s1c1
Sequence:CCGGGCGTTAGAAAGACCAGAGAAACTCGAGTTTCTCTGGTCTTTCTAACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024800.x-2736s1c1
Sequence:CCGGCCATGACTAATAAGGAAGATACTCGAGTATCTTCCTTATTAGTCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024800.x-1146s1c1
Sequence:CCGGCCTTACCTTGATGAGCAGCTACTCGAGTAGCTGCTCATCAAGGTAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024800.2-1169s1c1
Sequence:CCGGGAACCTAATGTGTAGATATTCCTCGAGGAATATCTACACATTAGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024800.2-486s1c1
Sequence:CCGGGTTGGAGAACTAAATCCAAATCTCGAGATTTGGATTTAGTTCTCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024800
NEK11 MISSION shRNA Lentiviral Transduction Particles
NIMA-related kinase 11
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024800.x-445s1c1
Sequence:CCGGCCAAACGAGGAGAGGAATTAACTCGAGTTAATTCCTCTCCTCGTTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024800.x-1797s1c1
Sequence:CCGGCCAGAGAAAGAAATCAGGAATCTCGAGATTCCTGATTTCTTTCTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024800.x-1785s1c1
Sequence:CCGGGCGTTAGAAAGACCAGAGAAACTCGAGTTTCTCTGGTCTTTCTAACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024800.x-2736s1c1
Sequence:CCGGCCATGACTAATAAGGAAGATACTCGAGTATCTTCCTTATTAGTCATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024800.x-1146s1c1
Sequence:CCGGCCTTACCTTGATGAGCAGCTACTCGAGTAGCTGCTCATCAAGGTAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024800.2-1169s1c1
Sequence:CCGGGAACCTAATGTGTAGATATTCCTCGAGGAATATCTACACATTAGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024800.2-486s1c1
Sequence:CCGGGTTGGAGAACTAAATCCAAATCTCGAGATTTGGATTTAGTTCTCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172461
NEK11 MISSION shRNA Bacterial Glycerol Stock
NIMA-related kinase 11
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172461.1-258s1c1
Sequence:CCGGCCGCTTTGATTGCAAGAAGATCTCGAGATCTTCTTGCAATCAAAGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172461.1-1498s1c1
Sequence:CCGGCCCACTTGTTGCTGAACAATACTCGAGTATTGTTCAGCAACAAGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172461.1-1046s1c1
Sequence:CCGGCCTTACATGGAAGAGCAGCTTCTCGAGAAGCTGCTCTTCCATGTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172461.1-1793s1c1
Sequence:CCGGCGCATGAAGGAATCAGCTGTACTCGAGTACAGCTGATTCCTTCATGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172461.1-462s1c1
Sequence:CCGGCCATTGTCAGATTCCATGCAACTCGAGTTGCATGGAATCTGACAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172461.3-1504s21c1
Sequence:CCGGATTGTTGACCTCGGACATTATCTCGAGATAATGTCCGAGGTCAACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172461.3-1743s21c1
Sequence:CCGGTCTAGACACAAAGACTATTACCTCGAGGTAATAGTCTTTGTGTCTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172461.3-418s21c1
Sequence:CCGGGAAATCTCTGTTGGCGAATTACTCGAGTAATTCGCCAACAGAGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172461.3-1411s21c1
Sequence:CCGGGAACTAGATGAACGGACTTTGCTCGAGCAAAGTCCGTTCATCTAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172461
NEK11 MISSION shRNA shRNA Plasmid DNA
NIMA-related kinase 11
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172461.1-258s1c1
Sequence:CCGGCCGCTTTGATTGCAAGAAGATCTCGAGATCTTCTTGCAATCAAAGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172461.1-1498s1c1
Sequence:CCGGCCCACTTGTTGCTGAACAATACTCGAGTATTGTTCAGCAACAAGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172461.1-1046s1c1
Sequence:CCGGCCTTACATGGAAGAGCAGCTTCTCGAGAAGCTGCTCTTCCATGTAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172461.1-1793s1c1
Sequence:CCGGCGCATGAAGGAATCAGCTGTACTCGAGTACAGCTGATTCCTTCATGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172461.1-462s1c1
Sequence:CCGGCCATTGTCAGATTCCATGCAACTCGAGTTGCATGGAATCTGACAATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172461.3-1504s21c1
Sequence:CCGGATTGTTGACCTCGGACATTATCTCGAGATAATGTCCGAGGTCAACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172461.3-1743s21c1
Sequence:CCGGTCTAGACACAAAGACTATTACCTCGAGGTAATAGTCTTTGTGTCTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172461.3-418s21c1
Sequence:CCGGGAAATCTCTGTTGGCGAATTACTCGAGTAATTCGCCAACAGAGATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172461.3-1411s21c1
Sequence:CCGGGAACTAGATGAACGGACTTTGCTCGAGCAAAGTCCGTTCATCTAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172461
NEK11 MISSION shRNA Lentiviral Transduction Particles
NIMA-related kinase 11
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172461.1-258s1c1
Sequence:CCGGCCGCTTTGATTGCAAGAAGATCTCGAGATCTTCTTGCAATCAAAGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172461.1-1498s1c1
Sequence:CCGGCCCACTTGTTGCTGAACAATACTCGAGTATTGTTCAGCAACAAGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172461.1-1046s1c1
Sequence:CCGGCCTTACATGGAAGAGCAGCTTCTCGAGAAGCTGCTCTTCCATGTAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172461.1-1793s1c1
Sequence:CCGGCGCATGAAGGAATCAGCTGTACTCGAGTACAGCTGATTCCTTCATGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172461.1-462s1c1
Sequence:CCGGCCATTGTCAGATTCCATGCAACTCGAGTTGCATGGAATCTGACAATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172461.3-1504s21c1
Sequence:CCGGATTGTTGACCTCGGACATTATCTCGAGATAATGTCCGAGGTCAACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172461.3-1743s21c1
Sequence:CCGGTCTAGACACAAAGACTATTACCTCGAGGTAATAGTCTTTGTGTCTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172461.3-418s21c1
Sequence:CCGGGAAATCTCTGTTGGCGAATTACTCGAGTAATTCGCCAACAGAGATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172461.3-1411s21c1
Sequence:CCGGGAACTAGATGAACGGACTTTGCTCGAGCAAAGTCCGTTCATCTAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)