EMAIL THIS PAGE TO A FRIEND

NEK1

NIMA-related kinase 1

208 Gene Product Result for
Synonyms: NY-REN-55 SRPS2 SRPS2A
Gene ID:
Human(4750) Summary: The protein encoded by this gene is a serine/threonine kinase involved in cell cycle regulation. The encoded protein is found in a centrosomal complex with FEZ1, a neuronal protein that plays a role in axonal development. Defects in this gene are a cause of polycystic kidney disease (PKD). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
Mouse(18004) NIMA (never in mitosis gene a)-related expressed kinase 1
Rat(290705) NIMA-related kinase 1
Thale Cress(841893) serine/threonine-protein kinase Nek1
Zebrafish(556002) NIMA (never in mitosis gene a)-related kinase 1
dog(486058) NIMA (never in mitosis gene a)-related kinase 1
domestic cat(101094016) NIMA (never in mitosis gene a)-related kinase 1
cow(534671) NIMA-related kinase 1
chicken(422433) NIMA (never in mitosis gene a)-related kinase 1
naked mole-rat(101703746) NIMA-related kinase 1
Domestic Rabbit(100346687) NIMA (never in mitosis gene a)-related kinase 1
domestic guinea pig(100726652) NIMA-related kinase 1
sheep(101114757) NIMA-related kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012224 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012224 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012224 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175089 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175089 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175089 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU064711 MISSION® esiRNA esiRNA targeting mouse Nek1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012224 Rosetta Predictions human pricing
NM_001106082 Rosetta Predictions rat pricing
NM_175089 Rosetta Predictions mouse pricing
XM_620663 Rosetta Predictions mouse pricing
XM_898020 Rosetta Predictions mouse pricing
XM_898029 Rosetta Predictions mouse pricing
XM_898051 Rosetta Predictions mouse pricing
XM_898060 Rosetta Predictions mouse pricing
XM_898071 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012224 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035385 predicted 4204
2 SASI_Hs01_00035386 predicted 1722
3 SASI_Hs02_00343899 predicted 717
4 SASI_Hs01_00035387 predicted 2015
5 SASI_Hs01_00035388 predicted 3566
6 SASI_Hs01_00035389 predicted 509
7 SASI_Hs01_00035391 predicted 1225
8 SASI_Hs01_00035392 predicted 1172
9 SASI_Hs02_00343900 predicted 3612
10 SASI_Hs02_00343901 predicted 1220
11 SASI_Hs01_00035390 predicted 833
12 SASI_Hs01_00035393 predicted 3981
13 SASI_Hs01_00035394 predicted 604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106082 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215452 predicted 1190
2 SASI_Rn02_00215453 predicted 1913
3 SASI_Rn02_00215454 predicted 2484
4 SASI_Rn02_00215455 predicted 2013
5 SASI_Rn02_00215456 predicted 1049
6 SASI_Rn02_00215457 predicted 846
7 SASI_Rn02_00215458 predicted 1233
8 SASI_Rn02_00215459 predicted 1291
9 SASI_Rn02_00215460 predicted 2357
10 SASI_Rn02_00215461 predicted 1317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175089 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345663 predicted 2036
2 SASI_Mm02_00345664 predicted 3953
3 SASI_Mm02_00345665 predicted 1067
4 SASI_Mm02_00345666 predicted 822
5 SASI_Mm02_00345667 predicted 2976
6 SASI_Mm02_00345668 predicted 1308
7 SASI_Mm02_00345669 predicted 685
8 SASI_Mm02_00345670 predicted 723
9 SASI_Mm02_00345671 predicted 592
10 SASI_Mm02_00345672 predicted 3403
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_620663 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216265 predicted 777
2 SASI_Mm01_00216266 predicted 4068
3 SASI_Mm01_00216267 predicted 1107
4 SASI_Mm01_00216268 predicted 857
5 SASI_Mm01_00216269 predicted 3096
6 SASI_Mm01_00216270 predicted 1344
7 SASI_Mm01_00216271 predicted 714
8 SASI_Mm01_00216272 predicted 758
9 SASI_Mm01_00216273 predicted 627
10 SASI_Mm01_00216274 predicted 3516
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898020 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210356 predicted 781
2 SASI_Mm01_00210357 predicted 2068
3 SASI_Mm01_00210358 predicted 1101
4 SASI_Mm01_00210359 predicted 2712
5 SASI_Mm01_00210360 predicted 859
6 SASI_Mm01_00210361 predicted 3005
7 SASI_Mm01_00210362 predicted 1341
8 SASI_Mm01_00210363 predicted 717
9 SASI_Mm01_00210364 predicted 756
10 SASI_Mm01_00210365 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898029 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00220383 predicted 1013
2 SASI_Mm01_00220384 predicted 1003
3 SASI_Mm01_00220385 predicted 953
4 SASI_Mm01_00220386 predicted 951
5 SASI_Mm01_00220387 predicted 989
6 SASI_Mm01_00220388 predicted 922
7 SASI_Mm01_00220389 predicted 958
8 SASI_Mm01_00220390 predicted 1039
9 SASI_Mm01_00220391 predicted 962
10 SASI_Mm01_00220392 predicted 1014
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898051 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217285 predicted 445
2 SASI_Mm01_00217286 predicted 1735
3 SASI_Mm01_00217287 predicted 770
4 SASI_Mm01_00217288 predicted 2381
5 SASI_Mm01_00217289 predicted 530
6 SASI_Mm01_00217290 predicted 2674
7 SASI_Mm01_00217291 predicted 1016
8 SASI_Mm01_00217292 predicted 387
9 SASI_Mm01_00217293 predicted 421
10 SASI_Mm01_00217294 predicted 2243
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898060 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231050 predicted 775
2 SASI_Mm01_00231051 predicted 4122
3 SASI_Mm01_00231052 predicted 1099
4 SASI_Mm01_00231053 predicted 862
5 SASI_Mm01_00231054 predicted 3142
6 SASI_Mm01_00231055 predicted 1341
7 SASI_Mm01_00231056 predicted 712
8 SASI_Mm01_00231057 predicted 749
9 SASI_Mm01_00231058 predicted 628
10 SASI_Mm01_00231059 predicted 3569
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898071 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230703 predicted 445
2 SASI_Mm01_00230704 predicted 1744
3 SASI_Mm01_00230705 predicted 3659
4 SASI_Mm01_00230706 predicted 768
5 SASI_Mm01_00230707 predicted 528
6 SASI_Mm01_00230708 predicted 2676
7 SASI_Mm01_00230709 predicted 1017
8 SASI_Mm01_00230710 predicted 381
9 SASI_Mm01_00230711 predicted 420
10 SASI_Mm01_00230712 predicted 3105
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012224
VALIDATED
NEK1 MISSION shRNA Bacterial Glycerol Stock
NIMA-related kinase 1
Human
23 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012224.1-1231s21c1
Sequence:GTACCGGCCATCAGTCAACTCCATATTGCTCGAGCAATATGGAGTTGACTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012224.1-4538s21c1
Sequence:GTACCGGGACCCAGAACCTGACTTAATGCTCGAGCATTAAGTCAGGTTCTGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012224.1-3230s21c1
Sequence:GTACCGGAGAGCTTGCCATGCACTATTACTCGAGTAATAGTGCATGGCAAGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012224.1-3381s21c1
Sequence:GTACCGGAGAGCCTGGAACCAATGATTCCTCGAGGAATCATTGGTTCCAGGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012224.1-1189s21c1
Sequence:GTACCGGAGTTTGGTGTCTCAGTTATTTCTCGAGAAATAACTGAGACACCAAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012224.1-2017s21c1
Sequence:CCGGAGATTGAAGGCGGTGTCTAAACTCGAGTTTAGACACCGCCTTCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012224.1-1417s21c1
Sequence:CCGGACAAAGCCTGCCGCTAAATATCTCGAGATATTTAGCGGCAGGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012224.1-750s21c1
Sequence:CCGGGGATCTGTTTAAGCGAATAAACTCGAGTTTATTCGCTTAAACAGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012224.1-3535s21c1
Sequence:CCGGTTTCGATCTCACTCGCATTTACTCGAGTAAATGCGAGTGAGATCGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012224.1-3535s1c1
Sequence:CCGGTTTCGATCTCACTCGCATTTACTCGAGTAAATGCGAGTGAGATCGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_012224.1-750s1c1
Sequence:CCGGGGATCTGTTTAAGCGAATAAACTCGAGTTTATTCGCTTAAACAGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012224.1-5283s21c1
Sequence:CCGGCCAGATGTTCTTCGTAATAAACTCGAGTTTATTACGAAGAACATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012224.1-2792s21c1
Sequence:GTACCGGTGATTCCTCTGGATGAGTTAACTCGAGTTAACTCATCCAGAGGAATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012224.1-2846s21c1
Sequence:GTACCGGATACAGTGGGAGAAGTTATTACTCGAGTAATAACTTCTCCCACTGTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012224.1-3285s21c1
Sequence:GTACCGGGGAAACTCAGTCGGCAGATAGCTCGAGCTATCTGCCGACTGAGTTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021579    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012224.1-4290s1c1
Sequence:CCGGCCTCAACTATATGAAAGCATTCTCGAGAATGCTTTCATATAGTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012224.1-1427s1c1
Sequence:CCGGCCGCTAAATATGGAATACCTTCTCGAGAAGGTATTCCATATTTAGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012224.1-2206s1c1
Sequence:CCGGCGCCAACAGATTAAAGCCAAACTCGAGTTTGGCTTTAATCTGTTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012224.1-3581s1c1
Sequence:CCGGCCTTGCTGATTGGACTTTCAACTCGAGTTGAAAGTCCAATCAGCAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012224.1-2620s1c1
Sequence:CCGGCGAGAAATACTTCGTAGATTACTCGAGTAATCTACGAAGTATTTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196437    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012224.1-5011s1c1
Sequence:CCGGGACTTAGCATATAGCTTAAAGCTCGAGCTTTAAGCTATATGCTAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012224.1-4029s1c1
Sequence:CCGGCGATAGTGTCTTTAACCATTTCTCGAGAAATGGTTAAAGACACTATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194960    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012224.1-5283s1c1
Sequence:CCGGCCAGATGTTCTTCGTAATAAACTCGAGTTTATTACGAAGAACATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012224
VALIDATED
NEK1 MISSION shRNA shRNA Plasmid DNA
NIMA-related kinase 1
Human
23 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012224.1-1231s21c1
Sequence:GTACCGGCCATCAGTCAACTCCATATTGCTCGAGCAATATGGAGTTGACTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012224.1-4538s21c1
Sequence:GTACCGGGACCCAGAACCTGACTTAATGCTCGAGCATTAAGTCAGGTTCTGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012224.1-3230s21c1
Sequence:GTACCGGAGAGCTTGCCATGCACTATTACTCGAGTAATAGTGCATGGCAAGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012224.1-3381s21c1
Sequence:GTACCGGAGAGCCTGGAACCAATGATTCCTCGAGGAATCATTGGTTCCAGGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012224.1-1189s21c1
Sequence:GTACCGGAGTTTGGTGTCTCAGTTATTTCTCGAGAAATAACTGAGACACCAAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012224.1-2017s21c1
Sequence:CCGGAGATTGAAGGCGGTGTCTAAACTCGAGTTTAGACACCGCCTTCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012224.1-1417s21c1
Sequence:CCGGACAAAGCCTGCCGCTAAATATCTCGAGATATTTAGCGGCAGGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012224.1-750s21c1
Sequence:CCGGGGATCTGTTTAAGCGAATAAACTCGAGTTTATTCGCTTAAACAGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012224.1-3535s21c1
Sequence:CCGGTTTCGATCTCACTCGCATTTACTCGAGTAAATGCGAGTGAGATCGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012224.1-3535s1c1
Sequence:CCGGTTTCGATCTCACTCGCATTTACTCGAGTAAATGCGAGTGAGATCGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_012224.1-750s1c1
Sequence:CCGGGGATCTGTTTAAGCGAATAAACTCGAGTTTATTCGCTTAAACAGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012224.1-5283s21c1
Sequence:CCGGCCAGATGTTCTTCGTAATAAACTCGAGTTTATTACGAAGAACATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012224.1-2792s21c1
Sequence:GTACCGGTGATTCCTCTGGATGAGTTAACTCGAGTTAACTCATCCAGAGGAATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012224.1-2846s21c1
Sequence:GTACCGGATACAGTGGGAGAAGTTATTACTCGAGTAATAACTTCTCCCACTGTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012224.1-3285s21c1
Sequence:GTACCGGGGAAACTCAGTCGGCAGATAGCTCGAGCTATCTGCCGACTGAGTTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021579    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012224.1-4290s1c1
Sequence:CCGGCCTCAACTATATGAAAGCATTCTCGAGAATGCTTTCATATAGTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012224.1-1427s1c1
Sequence:CCGGCCGCTAAATATGGAATACCTTCTCGAGAAGGTATTCCATATTTAGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012224.1-2206s1c1
Sequence:CCGGCGCCAACAGATTAAAGCCAAACTCGAGTTTGGCTTTAATCTGTTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012224.1-3581s1c1
Sequence:CCGGCCTTGCTGATTGGACTTTCAACTCGAGTTGAAAGTCCAATCAGCAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012224.1-2620s1c1
Sequence:CCGGCGAGAAATACTTCGTAGATTACTCGAGTAATCTACGAAGTATTTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196437    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012224.1-5011s1c1
Sequence:CCGGGACTTAGCATATAGCTTAAAGCTCGAGCTTTAAGCTATATGCTAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012224.1-4029s1c1
Sequence:CCGGCGATAGTGTCTTTAACCATTTCTCGAGAAATGGTTAAAGACACTATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194960    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012224.1-5283s1c1
Sequence:CCGGCCAGATGTTCTTCGTAATAAACTCGAGTTTATTACGAAGAACATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012224
VALIDATED
NEK1 MISSION shRNA Lentiviral Transduction Particles
NIMA-related kinase 1
Human
23 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012224.1-1231s21c1
Sequence:GTACCGGCCATCAGTCAACTCCATATTGCTCGAGCAATATGGAGTTGACTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012224.1-4538s21c1
Sequence:GTACCGGGACCCAGAACCTGACTTAATGCTCGAGCATTAAGTCAGGTTCTGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012224.1-3230s21c1
Sequence:GTACCGGAGAGCTTGCCATGCACTATTACTCGAGTAATAGTGCATGGCAAGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012224.1-3381s21c1
Sequence:GTACCGGAGAGCCTGGAACCAATGATTCCTCGAGGAATCATTGGTTCCAGGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012224.1-1189s21c1
Sequence:GTACCGGAGTTTGGTGTCTCAGTTATTTCTCGAGAAATAACTGAGACACCAAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012224.1-2017s21c1
Sequence:CCGGAGATTGAAGGCGGTGTCTAAACTCGAGTTTAGACACCGCCTTCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012224.1-1417s21c1
Sequence:CCGGACAAAGCCTGCCGCTAAATATCTCGAGATATTTAGCGGCAGGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012224.1-750s21c1
Sequence:CCGGGGATCTGTTTAAGCGAATAAACTCGAGTTTATTCGCTTAAACAGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012224.1-3535s21c1
Sequence:CCGGTTTCGATCTCACTCGCATTTACTCGAGTAAATGCGAGTGAGATCGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012224.1-3535s1c1
Sequence:CCGGTTTCGATCTCACTCGCATTTACTCGAGTAAATGCGAGTGAGATCGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_012224.1-750s1c1
Sequence:CCGGGGATCTGTTTAAGCGAATAAACTCGAGTTTATTCGCTTAAACAGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012224.1-5283s21c1
Sequence:CCGGCCAGATGTTCTTCGTAATAAACTCGAGTTTATTACGAAGAACATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012224.1-2792s21c1
Sequence:GTACCGGTGATTCCTCTGGATGAGTTAACTCGAGTTAACTCATCCAGAGGAATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012224.1-2846s21c1
Sequence:GTACCGGATACAGTGGGAGAAGTTATTACTCGAGTAATAACTTCTCCCACTGTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012224.1-3285s21c1
Sequence:GTACCGGGGAAACTCAGTCGGCAGATAGCTCGAGCTATCTGCCGACTGAGTTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021579    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012224.1-4290s1c1
Sequence:CCGGCCTCAACTATATGAAAGCATTCTCGAGAATGCTTTCATATAGTTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012224.1-1427s1c1
Sequence:CCGGCCGCTAAATATGGAATACCTTCTCGAGAAGGTATTCCATATTTAGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012224.1-2206s1c1
Sequence:CCGGCGCCAACAGATTAAAGCCAAACTCGAGTTTGGCTTTAATCTGTTGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012224.1-3581s1c1
Sequence:CCGGCCTTGCTGATTGGACTTTCAACTCGAGTTGAAAGTCCAATCAGCAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012224.1-2620s1c1
Sequence:CCGGCGAGAAATACTTCGTAGATTACTCGAGTAATCTACGAAGTATTTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196437    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012224.1-5011s1c1
Sequence:CCGGGACTTAGCATATAGCTTAAAGCTCGAGCTTTAAGCTATATGCTAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012224.1-4029s1c1
Sequence:CCGGCGATAGTGTCTTTAACCATTTCTCGAGAAATGGTTAAAGACACTATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194960    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012224.1-5283s1c1
Sequence:CCGGCCAGATGTTCTTCGTAATAAACTCGAGTTTATTACGAAGAACATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175089
VALIDATED
NEK1 MISSION shRNA Bacterial Glycerol Stock
NIMA-related kinase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175089.3-1520s21c1
Sequence:CCGGCGGAGTGCCTTTAACATATAACTCGAGTTATATGTTAAAGGCACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175089.3-3654s21c1
Sequence:CCGGCTGGAAGATGAACCAATTAAACTCGAGTTTAATTGGTTCATCTTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175089.3-1759s21c1
Sequence:CCGGAGCGGTTGGAGAGGATAAATACTCGAGTATTTATCCTCTCCAACCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175089.3-2786s21c1
Sequence:CCGGTACTGTGGGAGAGGTTATTAACTCGAGTTAATAACCTCTCCCACAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175089.3-2090s21c1
Sequence:CCGGAGCCGAAGGACACGTGGTTTACTCGAGTAAACCACGTGTCCTTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175089
VALIDATED
NEK1 MISSION shRNA shRNA Plasmid DNA
NIMA-related kinase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175089.3-1520s21c1
Sequence:CCGGCGGAGTGCCTTTAACATATAACTCGAGTTATATGTTAAAGGCACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175089.3-3654s21c1
Sequence:CCGGCTGGAAGATGAACCAATTAAACTCGAGTTTAATTGGTTCATCTTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175089.3-1759s21c1
Sequence:CCGGAGCGGTTGGAGAGGATAAATACTCGAGTATTTATCCTCTCCAACCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175089.3-2786s21c1
Sequence:CCGGTACTGTGGGAGAGGTTATTAACTCGAGTTAATAACCTCTCCCACAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175089.3-2090s21c1
Sequence:CCGGAGCCGAAGGACACGTGGTTTACTCGAGTAAACCACGTGTCCTTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175089
VALIDATED
NEK1 MISSION shRNA Lentiviral Transduction Particles
NIMA-related kinase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175089.3-1520s21c1
Sequence:CCGGCGGAGTGCCTTTAACATATAACTCGAGTTATATGTTAAAGGCACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175089.3-3654s21c1
Sequence:CCGGCTGGAAGATGAACCAATTAAACTCGAGTTTAATTGGTTCATCTTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175089.3-1759s21c1
Sequence:CCGGAGCGGTTGGAGAGGATAAATACTCGAGTATTTATCCTCTCCAACCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175089.3-2786s21c1
Sequence:CCGGTACTGTGGGAGAGGTTATTAACTCGAGTTAATAACCTCTCCCACAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175089.3-2090s21c1
Sequence:CCGGAGCCGAAGGACACGTGGTTTACTCGAGTAAACCACGTGTCCTTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)