EMAIL THIS PAGE TO A FRIEND

NEK2

NIMA-related kinase 2

85 Gene Product Result for
Synonyms: HsPK21 NEK2A NLK1
Gene ID:
Human(4751) Summary: This gene encodes a serine/threonine-protein kinase that is involved in mitotic regulation. This protein is localized to the centrosome, and undetectable during G1 phase, but accumulates progressively throughout the S phase, reaching maximal levels in late G2 phase. Alternatively spliced transcript variants encoding different isoforms with distinct C-termini have been noted for this gene. [provided by RefSeq, Feb 2011]
Mouse(18005) NIMA (never in mitosis gene a)-related expressed kinase 2
Rat(114482) NIMA (never in mitosis gene a)-related expressed kinase 2
sheep(101118973) NIMA-related kinase 2
domestic guinea pig(100715157) NIMA-related kinase 2
naked mole-rat(101707017) NIMA-related kinase 2
Domestic Rabbit(100339755) NIMA (never in mitosis gene a)-related kinase 2
fruit fly(31696) CG17256 gene product from transcript CG17256-RA
Zebrafish(394025) NIMA (never in mitosis gene a)-related kinase 2
cow(523998) NIMA (never in mitosis gene a)-related kinase 2
Horse(100054759) NIMA (never in mitosis gene a)-related kinase 2
domestic cat(101085774) NIMA (never in mitosis gene a)-related kinase 2
dog(480021) NIMA (never in mitosis gene a)-related kinase 2
chicken(421376) NIMA (never in mitosis gene a)-related kinase 2
Thale Cress(819641) serine/threonine-protein kinase Nek2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
N7288 Anti-NEK2 (426-440) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1300126 Anti-NEK2 (center) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
SAB1406177 Anti-NEK2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human, rat
immunofluorescence, western blot pricing
SAB1410834 Anti-NEK2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA064967 Anti-NEK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
WH0004751M2 Monoclonal Anti-NEK2 antibody produced in mouse clone 2F9, purified immunoglobulin, buffered aqueous solution human, rat
ELISA, immunofluorescence, western blot pricing
SAB1409356 Monoclonal Anti-NEK2 antibody produced in mouse clone 1C8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409357 Monoclonal Anti-NEK2 antibody produced in mouse clone 2A10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404117 Monoclonal Anti-NEK2, (C-terminal) antibody produced in mouse clone 2F6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002497 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002497 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002497 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010892 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010892 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010892 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002497 siRNAs that have been validated in the lab human pricing
XM_001055166 Rosetta Predictions rat pricing
XM_001069107 Rosetta Predictions rat pricing
NM_010892 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002497 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171650 validated 859
1 SASI_Hs01_00171651 validated 471
1 SASI_Hs01_00171649 validated 904
2 SASI_Hs02_00333954 predicted 840
3 SASI_Hs01_00171652 predicted 330
4 SASI_Hs01_00171654 predicted 695
5 SASI_Hs01_00171655 predicted 339
6 SASI_Hs01_00171656 predicted 362
7 SASI_Hs01_00171657 predicted 711
8 SASI_Hs02_00333955 predicted 372
9 SASI_Hs01_00171653 predicted 288
10 SASI_Hs01_00171658 predicted 1335
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055166 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278684 predicted 1653
2 SASI_Rn02_00278685 predicted 1759
3 SASI_Rn02_00278686 predicted 1624
4 SASI_Rn02_00278687 predicted 1884
5 SASI_Rn02_00278688 predicted 1749
6 SASI_Rn02_00278689 predicted 1823
7 SASI_Rn02_00278690 predicted 1879
8 SASI_Rn02_00278691 predicted 1730
9 SASI_Rn02_00278692 predicted 1864
10 SASI_Rn02_00278693 predicted 1778
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069107 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326932 predicted 1630
2 SASI_Rn02_00326933 predicted 749
3 SASI_Rn02_00326934 predicted 436
4 SASI_Rn02_00326935 predicted 1181
5 SASI_Rn02_00326936 predicted 430
6 SASI_Rn02_00326937 predicted 1492
7 SASI_Rn02_00326938 predicted 390
8 SASI_Rn02_00326939 predicted 1191
9 SASI_Rn02_00326940 predicted 257
10 SASI_Rn02_00326941 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010892 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168792 predicted 810
2 SASI_Mm01_00168793 predicted 384
3 SASI_Mm02_00319598 predicted 365
4 SASI_Mm01_00168796 predicted 729
5 SASI_Mm01_00168798 predicted 812
6 SASI_Mm01_00168799 predicted 534
7 SASI_Mm02_00319599 predicted 483
8 SASI_Mm01_00168800 predicted 1465
9 SASI_Mm02_00319600 predicted 1090
10 SASI_Mm02_00319601 predicted 414
11 SASI_Mm01_00168794 predicted 283
12 SASI_Mm01_00168795 predicted 1076
13 SASI_Mm01_00168797 predicted 706
14 SASI_Mm01_00168801 predicted 288
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002497
VALIDATED
NEK2 MISSION shRNA Bacterial Glycerol Stock
NIMA-related kinase 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002497.2-995s21c1
Sequence:GTACCGGTGAGAGAAGAGGGCGACAATTCTCGAGAATTGTCGCCCTCTTCTCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002497.2-426s1c1
Sequence:CCGGCTGGCTAGTGTAATTACAAAGCTCGAGCTTTGTAATTACACTAGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002497.2-539s21c1
Sequence:CCGGTGATGGTGGTCATACCGTATTCTCGAGAATACGGTATGACCACCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002497.2-972s21c1
Sequence:CCGGGCAGACGAGCAAAGAAGAAATCTCGAGATTTCTTCTTTGCTCGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002497.x-1571s1c1
Sequence:CCGGGCCATGCCTTTCTGTATAGTACTCGAGTACTATACAGAAAGGCATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002497.x-960s1c1
Sequence:CCGGGCAGACGAGCAAAGAAGAAATCTCGAGATTTCTTCTTTGCTCGTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002497.x-1035s1c1
Sequence:CCGGCCTGTATTGAGTGAGCTGAAACTCGAGTTTCAGCTCACTCAATACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002497.x-849s1c1
Sequence:CCGGCGTTACTCTGATGAATTGAATCTCGAGATTCAATTCATCAGAGTAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002497.x-335s1c1
Sequence:CCGGCGTTCGTTACTATGATCGGATCTCGAGATCCGATCATAGTAACGAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002497.2-1583s21c1
Sequence:CCGGGCCATGCCTTTCTGTATAGTACTCGAGTACTATACAGAAAGGCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002497.2-451s1c1
Sequence:CCGGCCAAGGAAAGGCAATACTTAGCTCGAGCTAAGTATTGCCTTTCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002497.2-623s21c1
Sequence:CCGGCTTTGGGCTAGCTAGAATATTCTCGAGAATATTCTAGCTAGCCCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002497.2-861s21c1
Sequence:CCGGCGTTACTCTGATGAATTGAATCTCGAGATTCAATTCATCAGAGTAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002497
VALIDATED
NEK2 MISSION shRNA shRNA Plasmid DNA
NIMA-related kinase 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002497.2-995s21c1
Sequence:GTACCGGTGAGAGAAGAGGGCGACAATTCTCGAGAATTGTCGCCCTCTTCTCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002497.2-426s1c1
Sequence:CCGGCTGGCTAGTGTAATTACAAAGCTCGAGCTTTGTAATTACACTAGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002497.2-539s21c1
Sequence:CCGGTGATGGTGGTCATACCGTATTCTCGAGAATACGGTATGACCACCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002497.2-972s21c1
Sequence:CCGGGCAGACGAGCAAAGAAGAAATCTCGAGATTTCTTCTTTGCTCGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002497.x-1571s1c1
Sequence:CCGGGCCATGCCTTTCTGTATAGTACTCGAGTACTATACAGAAAGGCATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002497.x-960s1c1
Sequence:CCGGGCAGACGAGCAAAGAAGAAATCTCGAGATTTCTTCTTTGCTCGTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002497.x-1035s1c1
Sequence:CCGGCCTGTATTGAGTGAGCTGAAACTCGAGTTTCAGCTCACTCAATACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002497.x-849s1c1
Sequence:CCGGCGTTACTCTGATGAATTGAATCTCGAGATTCAATTCATCAGAGTAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002497.x-335s1c1
Sequence:CCGGCGTTCGTTACTATGATCGGATCTCGAGATCCGATCATAGTAACGAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002497.2-1583s21c1
Sequence:CCGGGCCATGCCTTTCTGTATAGTACTCGAGTACTATACAGAAAGGCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002497.2-451s1c1
Sequence:CCGGCCAAGGAAAGGCAATACTTAGCTCGAGCTAAGTATTGCCTTTCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002497.2-623s21c1
Sequence:CCGGCTTTGGGCTAGCTAGAATATTCTCGAGAATATTCTAGCTAGCCCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002497.2-861s21c1
Sequence:CCGGCGTTACTCTGATGAATTGAATCTCGAGATTCAATTCATCAGAGTAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002497
VALIDATED
NEK2 MISSION shRNA Lentiviral Transduction Particles
NIMA-related kinase 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002497.2-995s21c1
Sequence:GTACCGGTGAGAGAAGAGGGCGACAATTCTCGAGAATTGTCGCCCTCTTCTCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002497.2-426s1c1
Sequence:CCGGCTGGCTAGTGTAATTACAAAGCTCGAGCTTTGTAATTACACTAGCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002497.2-539s21c1
Sequence:CCGGTGATGGTGGTCATACCGTATTCTCGAGAATACGGTATGACCACCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002497.2-972s21c1
Sequence:CCGGGCAGACGAGCAAAGAAGAAATCTCGAGATTTCTTCTTTGCTCGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002497.x-1571s1c1
Sequence:CCGGGCCATGCCTTTCTGTATAGTACTCGAGTACTATACAGAAAGGCATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002497.x-960s1c1
Sequence:CCGGGCAGACGAGCAAAGAAGAAATCTCGAGATTTCTTCTTTGCTCGTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002497.x-1035s1c1
Sequence:CCGGCCTGTATTGAGTGAGCTGAAACTCGAGTTTCAGCTCACTCAATACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002497.x-849s1c1
Sequence:CCGGCGTTACTCTGATGAATTGAATCTCGAGATTCAATTCATCAGAGTAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002497.x-335s1c1
Sequence:CCGGCGTTCGTTACTATGATCGGATCTCGAGATCCGATCATAGTAACGAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002497.2-1583s21c1
Sequence:CCGGGCCATGCCTTTCTGTATAGTACTCGAGTACTATACAGAAAGGCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002497.2-451s1c1
Sequence:CCGGCCAAGGAAAGGCAATACTTAGCTCGAGCTAAGTATTGCCTTTCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002497.2-623s21c1
Sequence:CCGGCTTTGGGCTAGCTAGAATATTCTCGAGAATATTCTAGCTAGCCCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002497.2-861s21c1
Sequence:CCGGCGTTACTCTGATGAATTGAATCTCGAGATTCAATTCATCAGAGTAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010892
VALIDATED
NEK2 MISSION shRNA Bacterial Glycerol Stock
NIMA-related kinase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010892.3-378s21c1
Sequence:CCGGAGTTACTATGATCGCATTATTCTCGAGAATAATGCGATCATAGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010892.3-1546s21c1
Sequence:CCGGACCCACTAGAGATTGGTATTCCTCGAGGAATACCAATCTCTAGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010892.3-1305s21c1
Sequence:CCGGGCCATGAAGAAGAAGGTTCATCTCGAGATGAACCTTCTTCTTCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010892.3-276s21c1
Sequence:CCGGGTGTGGAAAGAGCTTGACTATCTCGAGATAGTCAAGCTCTTTCCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010892.3-1401s21c1
Sequence:CCGGGACCTGAAGAAGAGGCTTCATCTCGAGATGAAGCCTCTTCTTCAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010892.1-289s1c1
Sequence:CCGGCGTTACTATGATCGCATTATTCTCGAGAATAATGCGATCATAGTAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010892.1-1312s1c1
Sequence:CCGGGACCTGAAGAAGAGGCTTCATCTCGAGATGAAGCCTCTTCTTCAGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010892.1-187s1c1
Sequence:CCGGGTGTGGAAAGAGCTTGACTATCTCGAGATAGTCAAGCTCTTTCCACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010892.1-723s1c1
Sequence:CCGGGCCTCCCTTTACAGCTTTCAACTCGAGTTGAAAGCTGTAAAGGGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010892.1-1216s1c1
Sequence:CCGGGCCATGAAGAAGAAGGTTCATCTCGAGATGAACCTTCTTCTTCATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010892
VALIDATED
NEK2 MISSION shRNA shRNA Plasmid DNA
NIMA-related kinase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010892.3-378s21c1
Sequence:CCGGAGTTACTATGATCGCATTATTCTCGAGAATAATGCGATCATAGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010892.3-1546s21c1
Sequence:CCGGACCCACTAGAGATTGGTATTCCTCGAGGAATACCAATCTCTAGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010892.3-1305s21c1
Sequence:CCGGGCCATGAAGAAGAAGGTTCATCTCGAGATGAACCTTCTTCTTCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010892.3-276s21c1
Sequence:CCGGGTGTGGAAAGAGCTTGACTATCTCGAGATAGTCAAGCTCTTTCCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010892.3-1401s21c1
Sequence:CCGGGACCTGAAGAAGAGGCTTCATCTCGAGATGAAGCCTCTTCTTCAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010892.1-289s1c1
Sequence:CCGGCGTTACTATGATCGCATTATTCTCGAGAATAATGCGATCATAGTAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010892.1-1312s1c1
Sequence:CCGGGACCTGAAGAAGAGGCTTCATCTCGAGATGAAGCCTCTTCTTCAGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010892.1-187s1c1
Sequence:CCGGGTGTGGAAAGAGCTTGACTATCTCGAGATAGTCAAGCTCTTTCCACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010892.1-723s1c1
Sequence:CCGGGCCTCCCTTTACAGCTTTCAACTCGAGTTGAAAGCTGTAAAGGGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010892.1-1216s1c1
Sequence:CCGGGCCATGAAGAAGAAGGTTCATCTCGAGATGAACCTTCTTCTTCATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010892
VALIDATED
NEK2 MISSION shRNA Lentiviral Transduction Particles
NIMA-related kinase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010892.3-378s21c1
Sequence:CCGGAGTTACTATGATCGCATTATTCTCGAGAATAATGCGATCATAGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010892.3-1546s21c1
Sequence:CCGGACCCACTAGAGATTGGTATTCCTCGAGGAATACCAATCTCTAGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010892.3-1305s21c1
Sequence:CCGGGCCATGAAGAAGAAGGTTCATCTCGAGATGAACCTTCTTCTTCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010892.3-276s21c1
Sequence:CCGGGTGTGGAAAGAGCTTGACTATCTCGAGATAGTCAAGCTCTTTCCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010892.3-1401s21c1
Sequence:CCGGGACCTGAAGAAGAGGCTTCATCTCGAGATGAAGCCTCTTCTTCAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010892.1-289s1c1
Sequence:CCGGCGTTACTATGATCGCATTATTCTCGAGAATAATGCGATCATAGTAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010892.1-1312s1c1
Sequence:CCGGGACCTGAAGAAGAGGCTTCATCTCGAGATGAAGCCTCTTCTTCAGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010892.1-187s1c1
Sequence:CCGGGTGTGGAAAGAGCTTGACTATCTCGAGATAGTCAAGCTCTTTCCACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010892.1-723s1c1
Sequence:CCGGGCCTCCCTTTACAGCTTTCAACTCGAGTTGAAAGCTGTAAAGGGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010892.1-1216s1c1
Sequence:CCGGGCCATGAAGAAGAAGGTTCATCTCGAGATGAACCTTCTTCTTCATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)