EMAIL THIS PAGE TO A FRIEND

NEK3

NIMA-related kinase 3

104 Gene Product Result for
Synonyms: HSPK36
UniProtKB ID: P51956, A8K2J4, Q5TAP2, Q8J023, Q8WUN5
Gene ID:
Human(4752) Summary: This gene encodes a member of the NimA (never in mitosis A) family of serine/threonine protein kinases. The encoded protein differs from other NimA family members in that it is not cell cycle regulated and is found primarily in the cytoplasm. The kinase is activated by prolactin stimulation, leading to phosphorylation of VAV2 guanine nucleotide exchange factor, paxillin, and activation of the RAC1 GTPase. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2009]
Mouse(23954) NIMA (never in mitosis gene a)-related expressed kinase 3
Rat(306576) NIMA-related kinase 3
Thale Cress(832912) serine/threonine-protein kinase Nek3
cow(505876) NIMA (never in mitosis gene a)-related kinase 3
Horse(100052419) NIMA (never in mitosis gene a)-related kinase 3
chicken(770196) NIMA (never in mitosis gene a)-related kinase 3
Domestic Rabbit(100345376) NIMA (never in mitosis gene a)-related kinase 3
naked mole-rat(101709817) NIMA-related kinase 3
sheep(101121103) NIMA-related kinase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152720 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152720 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152720 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011848 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011848 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011848 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002498 Rosetta Predictions human pricing
NM_152720 Rosetta Predictions human pricing
XM_001065115 Rosetta Predictions rat pricing
XM_224971 Rosetta Predictions rat pricing
NM_011848 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002498 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117898 predicted 678
2 SASI_Hs01_00117899 predicted 1608
3 SASI_Hs01_00117900 predicted 855
4 SASI_Hs01_00117901 predicted 1576
5 SASI_Hs01_00117902 predicted 946
6 SASI_Hs01_00117903 predicted 961
7 SASI_Hs02_00333956 predicted 975
8 SASI_Hs01_00117904 predicted 803
9 SASI_Hs01_00117905 predicted 1738
10 SASI_Hs01_00117906 predicted 586
11 SASI_Hs01_00117907 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073191 predicted 536
2 SASI_Hs01_00073192 predicted 1473
3 SASI_Hs01_00073193 predicted 709
4 SASI_Hs01_00073194 predicted 1438
5 SASI_Hs01_00073195 predicted 808
6 SASI_Hs01_00073196 predicted 818
7 SASI_Hs02_00366623 predicted 828
8 SASI_Hs01_00073197 predicted 660
9 SASI_Hs01_00073198 predicted 1589
10 SASI_Hs01_00073199 predicted 445
11 SASI_Hs01_00073200 predicted 600
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065115 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312932 predicted 252
2 SASI_Rn02_00312933 predicted 1097
3 SASI_Rn02_00312934 predicted 371
4 SASI_Rn02_00312935 predicted 264
5 SASI_Rn02_00312936 predicted 895
6 SASI_Rn02_00312937 predicted 910
7 SASI_Rn02_00312938 predicted 610
8 SASI_Rn02_00312939 predicted 912
9 SASI_Rn02_00312940 predicted 720
10 SASI_Rn02_00312941 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224971 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382407 predicted 258
2 SASI_Rn02_00382408 predicted 370
3 SASI_Rn02_00382409 predicted 311
4 SASI_Rn02_00382410 predicted 265
5 SASI_Rn02_00382411 predicted 272
6 SASI_Rn02_00382412 predicted 312
7 SASI_Rn02_00382413 predicted 305
8 SASI_Rn02_00382414 predicted 311
9 SASI_Rn02_00382415 predicted 372
10 SASI_Rn02_00382416 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011848 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098928 predicted 363
2 SASI_Mm01_00098929 predicted 890
3 SASI_Mm01_00098930 predicted 1657
4 SASI_Mm01_00098932 predicted 1202
5 SASI_Mm01_00098933 predicted 1346
6 SASI_Mm02_00321591 predicted 1027
7 SASI_Mm01_00098934 predicted 441
8 SASI_Mm01_00098935 predicted 1250
9 SASI_Mm02_00321592 predicted 629
10 SASI_Mm01_00098936 predicted 1449
11 SASI_Mm01_00098931 predicted 1355
12 SASI_Mm01_00098937 predicted 661
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152720
VALIDATED
NEK3 MISSION shRNA Bacterial Glycerol Stock
NIMA-related kinase 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152720.x-1996s1c1
Sequence:CCGGGCAGTCCCATAGAACAGAAATCTCGAGATTTCTGTTCTATGGGACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152720.x-931s1c1
Sequence:CCGGCCTAGTCAAGCAGATGTTTAACTCGAGTTAAACATCTGCTTGACTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152720.x-731s1c1
Sequence:CCGGCCTTATTATGTGCCTCCAGAACTCGAGTTCTGGAGGCACATAATAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152720.x-1293s1c1
Sequence:CCGGCCAGTTCACCAAATCTTCATACTCGAGTATGAAGATTTGGTGAACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152720.x-1086s1c1
Sequence:CCGGCGAAGCATAACACACCAAGAACTCGAGTTCTTGGTGTGTTATGCTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152720.1-822s1c1
Sequence:CCGGGTACCCTTAAGCATCCATTTCCTCGAGGAAATGGATGCTTAAGGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194828    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152720.1-2079s1c1
Sequence:CCGGCCCAATTTCCTCAACCATAAACTCGAGTTTATGGTTGAGGAAATTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152720.1-414s1c1
Sequence:CCGGCTAATATTGTTGCCTTCAAAGCTCGAGCTTTGAAGGCAACAATATTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152720.1-901s1c1
Sequence:CCGGGCCGTCTCATTACTCCTATGACTCGAGTCATAGGAGTAATGAGACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152720
VALIDATED
NEK3 MISSION shRNA shRNA Plasmid DNA
NIMA-related kinase 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152720.x-1996s1c1
Sequence:CCGGGCAGTCCCATAGAACAGAAATCTCGAGATTTCTGTTCTATGGGACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152720.x-931s1c1
Sequence:CCGGCCTAGTCAAGCAGATGTTTAACTCGAGTTAAACATCTGCTTGACTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152720.x-731s1c1
Sequence:CCGGCCTTATTATGTGCCTCCAGAACTCGAGTTCTGGAGGCACATAATAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152720.x-1293s1c1
Sequence:CCGGCCAGTTCACCAAATCTTCATACTCGAGTATGAAGATTTGGTGAACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152720.x-1086s1c1
Sequence:CCGGCGAAGCATAACACACCAAGAACTCGAGTTCTTGGTGTGTTATGCTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152720.1-822s1c1
Sequence:CCGGGTACCCTTAAGCATCCATTTCCTCGAGGAAATGGATGCTTAAGGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194828    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152720.1-2079s1c1
Sequence:CCGGCCCAATTTCCTCAACCATAAACTCGAGTTTATGGTTGAGGAAATTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152720.1-414s1c1
Sequence:CCGGCTAATATTGTTGCCTTCAAAGCTCGAGCTTTGAAGGCAACAATATTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152720.1-901s1c1
Sequence:CCGGGCCGTCTCATTACTCCTATGACTCGAGTCATAGGAGTAATGAGACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152720
VALIDATED
NEK3 MISSION shRNA Lentiviral Transduction Particles
NIMA-related kinase 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152720.x-1996s1c1
Sequence:CCGGGCAGTCCCATAGAACAGAAATCTCGAGATTTCTGTTCTATGGGACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152720.x-931s1c1
Sequence:CCGGCCTAGTCAAGCAGATGTTTAACTCGAGTTAAACATCTGCTTGACTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152720.x-731s1c1
Sequence:CCGGCCTTATTATGTGCCTCCAGAACTCGAGTTCTGGAGGCACATAATAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152720.x-1293s1c1
Sequence:CCGGCCAGTTCACCAAATCTTCATACTCGAGTATGAAGATTTGGTGAACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152720.x-1086s1c1
Sequence:CCGGCGAAGCATAACACACCAAGAACTCGAGTTCTTGGTGTGTTATGCTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152720.1-822s1c1
Sequence:CCGGGTACCCTTAAGCATCCATTTCCTCGAGGAAATGGATGCTTAAGGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194828    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152720.1-2079s1c1
Sequence:CCGGCCCAATTTCCTCAACCATAAACTCGAGTTTATGGTTGAGGAAATTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152720.1-414s1c1
Sequence:CCGGCTAATATTGTTGCCTTCAAAGCTCGAGCTTTGAAGGCAACAATATTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152720.1-901s1c1
Sequence:CCGGGCCGTCTCATTACTCCTATGACTCGAGTCATAGGAGTAATGAGACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011848
VALIDATED
NEK3 MISSION shRNA Bacterial Glycerol Stock
NIMA-related kinase 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011848.1-1440s1c1
Sequence:CCGGCGGTGATCTTGATTCTGTCATCTCGAGATGACAGAATCAAGATCACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011848.1-1336s1c1
Sequence:CCGGGCTGATCTCAGTCAGGCATTTCTCGAGAAATGCCTGACTGAGATCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011848.1-1028s1c1
Sequence:CCGGGTAGCCATACTGAATTGGAAACTCGAGTTTCCAATTCAGTATGGCTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011848.1-372s1c1
Sequence:CCGGCCCTGAAGACACGATACTTAACTCGAGTTAAGTATCGTGTCTTCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011848.4-1869s21c1
Sequence:CCGGTAACTCCTTTGATCCCAAATCCTCGAGGATTTGGGATCAAAGGAGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011848.4-411s21c1
Sequence:CCGGACACGATACTTAATTGGTTTACTCGAGTAAACCAATTAAGTATCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011848.4-362s21c1
Sequence:CCGGGATCTGATGCAGAGGATTAAACTCGAGTTTAATCCTCTGCATCAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011848.4-1743s21c1
Sequence:CCGGTCCAGAACCCTTGCGAGATTTCTCGAGAAATCTCGCAAGGGTTCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011848.4-702s21c1
Sequence:CCGGAGCATCCATTCCAGGCAAATACTCGAGTATTTGCCTGGAATGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011848.4-589s21c1
Sequence:CCGGGTACGTGGGAACACCTTATTACTCGAGTAATAAGGTGTTCCCACGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011848
VALIDATED
NEK3 MISSION shRNA shRNA Plasmid DNA
NIMA-related kinase 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011848.1-1440s1c1
Sequence:CCGGCGGTGATCTTGATTCTGTCATCTCGAGATGACAGAATCAAGATCACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011848.1-1336s1c1
Sequence:CCGGGCTGATCTCAGTCAGGCATTTCTCGAGAAATGCCTGACTGAGATCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011848.1-1028s1c1
Sequence:CCGGGTAGCCATACTGAATTGGAAACTCGAGTTTCCAATTCAGTATGGCTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011848.1-372s1c1
Sequence:CCGGCCCTGAAGACACGATACTTAACTCGAGTTAAGTATCGTGTCTTCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011848.4-1869s21c1
Sequence:CCGGTAACTCCTTTGATCCCAAATCCTCGAGGATTTGGGATCAAAGGAGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011848.4-411s21c1
Sequence:CCGGACACGATACTTAATTGGTTTACTCGAGTAAACCAATTAAGTATCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011848.4-362s21c1
Sequence:CCGGGATCTGATGCAGAGGATTAAACTCGAGTTTAATCCTCTGCATCAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011848.4-1743s21c1
Sequence:CCGGTCCAGAACCCTTGCGAGATTTCTCGAGAAATCTCGCAAGGGTTCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011848.4-702s21c1
Sequence:CCGGAGCATCCATTCCAGGCAAATACTCGAGTATTTGCCTGGAATGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011848.4-589s21c1
Sequence:CCGGGTACGTGGGAACACCTTATTACTCGAGTAATAAGGTGTTCCCACGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011848
VALIDATED
NEK3 MISSION shRNA Lentiviral Transduction Particles
NIMA-related kinase 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011848.1-1440s1c1
Sequence:CCGGCGGTGATCTTGATTCTGTCATCTCGAGATGACAGAATCAAGATCACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011848.1-1336s1c1
Sequence:CCGGGCTGATCTCAGTCAGGCATTTCTCGAGAAATGCCTGACTGAGATCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011848.1-1028s1c1
Sequence:CCGGGTAGCCATACTGAATTGGAAACTCGAGTTTCCAATTCAGTATGGCTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011848.1-372s1c1
Sequence:CCGGCCCTGAAGACACGATACTTAACTCGAGTTAAGTATCGTGTCTTCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011848.4-1869s21c1
Sequence:CCGGTAACTCCTTTGATCCCAAATCCTCGAGGATTTGGGATCAAAGGAGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011848.4-411s21c1
Sequence:CCGGACACGATACTTAATTGGTTTACTCGAGTAAACCAATTAAGTATCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011848.4-362s21c1
Sequence:CCGGGATCTGATGCAGAGGATTAAACTCGAGTTTAATCCTCTGCATCAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011848.4-1743s21c1
Sequence:CCGGTCCAGAACCCTTGCGAGATTTCTCGAGAAATCTCGCAAGGGTTCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011848.4-702s21c1
Sequence:CCGGAGCATCCATTCCAGGCAAATACTCGAGTATTTGCCTGGAATGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011848.4-589s21c1
Sequence:CCGGGTACGTGGGAACACCTTATTACTCGAGTAATAAGGTGTTCCCACGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)