EMAIL THIS PAGE TO A FRIEND

NEK4

NIMA-related kinase 4

69 Gene Product Result for
Synonyms: NRK2 STK2 pp12301
UniProtKB ID: P51957, A5YM70, B2R633, B7Z200, Q6P576
Gene ID:
Mouse(23955) NIMA (never in mitosis gene a)-related expressed kinase 4
Rat(306252) NIMA-related kinase 4
sheep(101110544) NIMA-related kinase 4
naked mole-rat(101696587) NIMA-related kinase 4
domestic guinea pig(100727641) NIMA-related kinase 4
Thale Cress(825503) serine/threonine-protein kinase Nek4
chicken(415900) NIMA (never in mitosis gene a)-related kinase 4
cow(511455) NIMA (never in mitosis gene a)-related kinase 4
Horse(100051545) NIMA (never in mitosis gene a)-related kinase 4
domestic cat(101093171) NIMA (never in mitosis gene a)-related kinase 4
dog(476591) NIMA (never in mitosis gene a)-related kinase 4
Zebrafish(393987) NIMA (never in mitosis gene a)-related kinase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003157 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003157 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003157 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011849 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011849 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011849 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003157 Rosetta Predictions human pricing
NM_001013134 Rosetta Predictions rat pricing
NM_011849 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003157 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138574 predicted 2662
2 SASI_Hs01_00138575 predicted 692
3 SASI_Hs01_00138576 predicted 724
4 SASI_Hs02_00335164 predicted 497
5 SASI_Hs01_00138578 predicted 1279
6 SASI_Hs01_00138579 predicted 2517
7 SASI_Hs01_00138580 predicted 230
8 SASI_Hs01_00138581 predicted 1253
9 SASI_Hs01_00138583 predicted 1308
10 SASI_Hs02_00335165 predicted 956
11 SASI_Hs01_00138577 predicted 846
12 SASI_Hs01_00138582 predicted 704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013134 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200848 predicted 2318
2 SASI_Rn02_00200849 predicted 625
3 SASI_Rn02_00200850 predicted 1136
4 SASI_Rn02_00200851 predicted 1762
5 SASI_Rn02_00200852 predicted 1385
6 SASI_Rn02_00200853 predicted 1087
7 SASI_Rn02_00200854 predicted 2291
8 SASI_Rn02_00200855 predicted 2028
9 SASI_Rn02_00200856 predicted 1502
10 SASI_Rn02_00200857 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011849 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136750 predicted 1220
2 SASI_Mm01_00136751 predicted 1675
3 SASI_Mm01_00136752 predicted 2029
4 SASI_Mm01_00136753 predicted 1312
5 SASI_Mm01_00136754 predicted 1207
6 SASI_Mm01_00136755 predicted 2163
7 SASI_Mm01_00136756 predicted 1144
8 SASI_Mm01_00136757 predicted 2194
9 SASI_Mm01_00136759 predicted 1129
10 SASI_Mm02_00321593 predicted 2034
11 SASI_Mm01_00136758 predicted 1639
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003157
VALIDATED
NEK4 MISSION shRNA Bacterial Glycerol Stock
NIMA-related kinase 4
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003157.1-2267s1c1
Sequence:CCGGGAAGGGAAAGGTCAGACAAATCTCGAGATTTGTCTGACCTTTCCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003157.1-1269s1c1
Sequence:CCGGGCGTAAATATTGACATCTTACCTCGAGGTAAGATGTCAATATTTACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003157.1-3109s1c1
Sequence:CCGGGTCGTCATAATTCCTGCTATTCTCGAGAATAGCAGGAATTATGACGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003157.1-881s1c1
Sequence:CCGGGCAGAACTGATAAGAACAATGCTCGAGCATTGTTCTTATCAGTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003157.1-2322s1c1
Sequence:CCGGCCCTGAAACTGGATTCTAAAGCTCGAGCTTTAGAATCCAGTTTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_003157.1-3138s1c1
Sequence:CCGGCCTTAAGGAGTAGTTGATAAACTCGAGTTTATCAACTACTCCTTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003157.1-1998s1c1
Sequence:CCGGCATCAAAGGATCGACCATTATCTCGAGATAATGGTCGATCCTTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003157.x-687s1c1
Sequence:CCGGCCTACTACATGAGCCCTGAATCTCGAGATTCAGGGCTCATGTAGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003157.x-2949s1c1
Sequence:CCGGGATTACTGTTTACTGAGCCTTCTCGAGAAGGCTCAGTAAACAGTAATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003157.x-340s1c1
Sequence:CCGGCCAGCTCTTGTCTCAGTTGAACTCGAGTTCAACTGAGACAAGAGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003157.x-1257s1c1
Sequence:CCGGCCACAATCAGTAGCGTAAATACTCGAGTATTTACGCTACTGATTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003157.x-262s1c1
Sequence:CCGGCGGCAAGCAGTATGTCATCAACTCGAGTTGATGACATACTGCTTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003157
VALIDATED
NEK4 MISSION shRNA shRNA Plasmid DNA
NIMA-related kinase 4
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003157.1-2267s1c1
Sequence:CCGGGAAGGGAAAGGTCAGACAAATCTCGAGATTTGTCTGACCTTTCCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003157.1-1269s1c1
Sequence:CCGGGCGTAAATATTGACATCTTACCTCGAGGTAAGATGTCAATATTTACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003157.1-3109s1c1
Sequence:CCGGGTCGTCATAATTCCTGCTATTCTCGAGAATAGCAGGAATTATGACGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003157.1-881s1c1
Sequence:CCGGGCAGAACTGATAAGAACAATGCTCGAGCATTGTTCTTATCAGTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003157.1-2322s1c1
Sequence:CCGGCCCTGAAACTGGATTCTAAAGCTCGAGCTTTAGAATCCAGTTTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_003157.1-3138s1c1
Sequence:CCGGCCTTAAGGAGTAGTTGATAAACTCGAGTTTATCAACTACTCCTTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003157.1-1998s1c1
Sequence:CCGGCATCAAAGGATCGACCATTATCTCGAGATAATGGTCGATCCTTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003157.x-687s1c1
Sequence:CCGGCCTACTACATGAGCCCTGAATCTCGAGATTCAGGGCTCATGTAGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003157.x-2949s1c1
Sequence:CCGGGATTACTGTTTACTGAGCCTTCTCGAGAAGGCTCAGTAAACAGTAATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003157.x-340s1c1
Sequence:CCGGCCAGCTCTTGTCTCAGTTGAACTCGAGTTCAACTGAGACAAGAGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003157.x-1257s1c1
Sequence:CCGGCCACAATCAGTAGCGTAAATACTCGAGTATTTACGCTACTGATTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003157.x-262s1c1
Sequence:CCGGCGGCAAGCAGTATGTCATCAACTCGAGTTGATGACATACTGCTTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003157
VALIDATED
NEK4 MISSION shRNA Lentiviral Transduction Particles
NIMA-related kinase 4
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003157.1-2267s1c1
Sequence:CCGGGAAGGGAAAGGTCAGACAAATCTCGAGATTTGTCTGACCTTTCCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003157.1-1269s1c1
Sequence:CCGGGCGTAAATATTGACATCTTACCTCGAGGTAAGATGTCAATATTTACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003157.1-3109s1c1
Sequence:CCGGGTCGTCATAATTCCTGCTATTCTCGAGAATAGCAGGAATTATGACGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003157.1-881s1c1
Sequence:CCGGGCAGAACTGATAAGAACAATGCTCGAGCATTGTTCTTATCAGTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003157.1-2322s1c1
Sequence:CCGGCCCTGAAACTGGATTCTAAAGCTCGAGCTTTAGAATCCAGTTTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_003157.1-3138s1c1
Sequence:CCGGCCTTAAGGAGTAGTTGATAAACTCGAGTTTATCAACTACTCCTTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003157.1-1998s1c1
Sequence:CCGGCATCAAAGGATCGACCATTATCTCGAGATAATGGTCGATCCTTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003157.x-687s1c1
Sequence:CCGGCCTACTACATGAGCCCTGAATCTCGAGATTCAGGGCTCATGTAGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003157.x-2949s1c1
Sequence:CCGGGATTACTGTTTACTGAGCCTTCTCGAGAAGGCTCAGTAAACAGTAATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003157.x-340s1c1
Sequence:CCGGCCAGCTCTTGTCTCAGTTGAACTCGAGTTCAACTGAGACAAGAGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003157.x-1257s1c1
Sequence:CCGGCCACAATCAGTAGCGTAAATACTCGAGTATTTACGCTACTGATTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003157.x-262s1c1
Sequence:CCGGCGGCAAGCAGTATGTCATCAACTCGAGTTGATGACATACTGCTTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011849
VALIDATED
NEK4 MISSION shRNA Bacterial Glycerol Stock
NIMA-related kinase 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011849.1-1220s1c1
Sequence:CCGGCCACAATCAGTAGGATAAATACTCGAGTATTTATCCTACTGATTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011849.1-1565s1c1
Sequence:CCGGGCTCTATGTCTGAACCTTCTTCTCGAGAAGAAGGTTCAGACATAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011849.1-1464s1c1
Sequence:CCGGGCCATTGTATCCCTCAAATAACTCGAGTTATTTGAGGGATACAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011849.1-1751s1c1
Sequence:CCGGCTGGGTGTGTAAACAGTTCAACTCGAGTTGAACTGTTTACACACCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011849.1-366s1c1
Sequence:CCGGCGGTCTGCTCTACATTGTCATCTCGAGATGACAATGTAGAGCAGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011849.1-2368s1c1
Sequence:CCGGCAACTCTTAGAGCAGGTGTTTCTCGAGAAACACCTGCTCTAAGAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011849.1-661s1c1
Sequence:CCGGCCTGAGCTGTTCTCCAACAAACTCGAGTTTGTTGGAGAACAGCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011849.1-1087s1c1
Sequence:CCGGGCTTTGCATGTCATGGGTGAACTCGAGTTCACCCATGACATGCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011849
VALIDATED
NEK4 MISSION shRNA shRNA Plasmid DNA
NIMA-related kinase 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011849.1-1220s1c1
Sequence:CCGGCCACAATCAGTAGGATAAATACTCGAGTATTTATCCTACTGATTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011849.1-1565s1c1
Sequence:CCGGGCTCTATGTCTGAACCTTCTTCTCGAGAAGAAGGTTCAGACATAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011849.1-1464s1c1
Sequence:CCGGGCCATTGTATCCCTCAAATAACTCGAGTTATTTGAGGGATACAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011849.1-1751s1c1
Sequence:CCGGCTGGGTGTGTAAACAGTTCAACTCGAGTTGAACTGTTTACACACCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011849.1-366s1c1
Sequence:CCGGCGGTCTGCTCTACATTGTCATCTCGAGATGACAATGTAGAGCAGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011849.1-2368s1c1
Sequence:CCGGCAACTCTTAGAGCAGGTGTTTCTCGAGAAACACCTGCTCTAAGAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011849.1-661s1c1
Sequence:CCGGCCTGAGCTGTTCTCCAACAAACTCGAGTTTGTTGGAGAACAGCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011849.1-1087s1c1
Sequence:CCGGGCTTTGCATGTCATGGGTGAACTCGAGTTCACCCATGACATGCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011849
VALIDATED
NEK4 MISSION shRNA Lentiviral Transduction Particles
NIMA-related kinase 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011849.1-1220s1c1
Sequence:CCGGCCACAATCAGTAGGATAAATACTCGAGTATTTATCCTACTGATTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011849.1-1565s1c1
Sequence:CCGGGCTCTATGTCTGAACCTTCTTCTCGAGAAGAAGGTTCAGACATAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011849.1-1464s1c1
Sequence:CCGGGCCATTGTATCCCTCAAATAACTCGAGTTATTTGAGGGATACAATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011849.1-1751s1c1
Sequence:CCGGCTGGGTGTGTAAACAGTTCAACTCGAGTTGAACTGTTTACACACCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011849.1-366s1c1
Sequence:CCGGCGGTCTGCTCTACATTGTCATCTCGAGATGACAATGTAGAGCAGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011849.1-2368s1c1
Sequence:CCGGCAACTCTTAGAGCAGGTGTTTCTCGAGAAACACCTGCTCTAAGAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011849.1-661s1c1
Sequence:CCGGCCTGAGCTGTTCTCCAACAAACTCGAGTTTGTTGGAGAACAGCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011849.1-1087s1c1
Sequence:CCGGGCTTTGCATGTCATGGGTGAACTCGAGTTCACCCATGACATGCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)