EMAIL THIS PAGE TO A FRIEND

NEK5

NIMA-related kinase 5

51 Gene Product Result for
UniProtKB ID: Q6P3R8, Q5TAP5
Gene ID:
Mouse(330721) NIMA (never in mitosis gene a)-related expressed kinase 5
Rat(685440) NIMA-related kinase 5
Thale Cress(821634) NIMA-related kinase 5
cow(100138147) NIMA-related kinase 5
Horse(100052593) NIMA (never in mitosis gene a)-related kinase 5
domestic cat(101097612) NIMA (never in mitosis gene a)-related kinase 5
chicken(418881) NIMA (never in mitosis gene a)-related kinase 5
naked mole-rat(101711997) NIMA-related kinase 5
Domestic Rabbit(100345120) NIMA (never in mitosis gene a)-related kinase 5
sheep(101107110) NIMA-related kinase 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199289 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199289 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199289 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177898 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177898 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177898 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_292160 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_292160 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_292160 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199289 Rosetta Predictions human pricing
NM_177898 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032169 predicted 2013
2 SASI_Hs01_00032170 predicted 307
3 SASI_Hs01_00032171 predicted 507
4 SASI_Hs01_00032172 predicted 620
5 SASI_Hs01_00032173 predicted 2267
6 SASI_Hs01_00032174 predicted 1405
7 SASI_Hs01_00032176 predicted 2272
8 SASI_Hs01_00032177 predicted 344
9 SASI_Hs01_00032178 predicted 958
10 SASI_Hs02_00372718 predicted 1450
11 SASI_Hs01_00032175 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177898 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040512 predicted 856
2 SASI_Mm01_00040513 predicted 1686
3 SASI_Mm02_00348376 predicted 210
4 SASI_Mm01_00040514 predicted 1230
5 SASI_Mm01_00040515 predicted 417
6 SASI_Mm01_00040516 predicted 1683
7 SASI_Mm01_00040518 predicted 539
8 SASI_Mm01_00040519 predicted 1371
9 SASI_Mm01_00040520 predicted 1099
10 SASI_Mm01_00040521 predicted 1390
11 SASI_Mm01_00040517 predicted 1252
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199289
NEK5 MISSION shRNA Bacterial Glycerol Stock
NIMA-related kinase 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197162    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199289.1-2460s1c1
Sequence:CCGGGAAGGACAGCTGACTTGATTTCTCGAGAAATCAAGTCAGCTGTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199289.1-1978s1c1
Sequence:CCGGGCATGAAGTTTAAGGAATATGCTCGAGCATATTCCTTAAACTTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199289.1-2511s21c1
Sequence:CCGGTTCGATTTCATAGGGTCATTTCTCGAGAAATGACCCTATGAAATCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199289.1-470s21c1
Sequence:CCGGACAGATTTCTCTAGGACTAAACTCGAGTTTAGTCCTAGAGAAATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199289.1-181s21c1
Sequence:CCGGCCTTCGGGAAAGCATACTTAGCTCGAGCTAAGTATGCTTTCCCGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199289
NEK5 MISSION shRNA shRNA Plasmid DNA
NIMA-related kinase 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197162    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199289.1-2460s1c1
Sequence:CCGGGAAGGACAGCTGACTTGATTTCTCGAGAAATCAAGTCAGCTGTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199289.1-1978s1c1
Sequence:CCGGGCATGAAGTTTAAGGAATATGCTCGAGCATATTCCTTAAACTTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199289.1-2511s21c1
Sequence:CCGGTTCGATTTCATAGGGTCATTTCTCGAGAAATGACCCTATGAAATCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199289.1-470s21c1
Sequence:CCGGACAGATTTCTCTAGGACTAAACTCGAGTTTAGTCCTAGAGAAATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199289.1-181s21c1
Sequence:CCGGCCTTCGGGAAAGCATACTTAGCTCGAGCTAAGTATGCTTTCCCGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199289
NEK5 MISSION shRNA Lentiviral Transduction Particles
NIMA-related kinase 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197162    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199289.1-2460s1c1
Sequence:CCGGGAAGGACAGCTGACTTGATTTCTCGAGAAATCAAGTCAGCTGTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199289.1-1978s1c1
Sequence:CCGGGCATGAAGTTTAAGGAATATGCTCGAGCATATTCCTTAAACTTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199289.1-2511s21c1
Sequence:CCGGTTCGATTTCATAGGGTCATTTCTCGAGAAATGACCCTATGAAATCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199289.1-470s21c1
Sequence:CCGGACAGATTTCTCTAGGACTAAACTCGAGTTTAGTCCTAGAGAAATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199289.1-181s21c1
Sequence:CCGGCCTTCGGGAAAGCATACTTAGCTCGAGCTAAGTATGCTTTCCCGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177898
NEK5 MISSION shRNA Bacterial Glycerol Stock
NIMA-related kinase 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177898.3-945s1c1
Sequence:CCGGCCACAGCTTGTTGGAGAGTTACTCGAGTAACTCTCCAACAAGCTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177898.3-1430s1c1
Sequence:CCGGCCAGAAGCAGAGGGTTTCTTTCTCGAGAAAGAAACCCTCTGCTTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177898.3-767s1c1
Sequence:CCGGCGTGACCTACAGTCCTTGATACTCGAGTATCAAGGACTGTAGGTCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177898.3-218s1c1
Sequence:CCGGGCCTCAAAGAACGAAGTGATTCTCGAGAATCACTTCGTTCTTTGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177898.3-1683s1c1
Sequence:CCGGCCAGTAAAGGAGAAACCGTAACTCGAGTTACGGTTTCTCCTTTACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177898.4-415s21c1
Sequence:CCGGCTCTAGGACTGAAGCATATTCCTCGAGGAATATGCTTCAGTCCTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177898.4-1499s21c1
Sequence:CCGGTCACACTCTGCTGCGAATAATCTCGAGATTATTCGCAGCAGAGTGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177898.4-1094s21c1
Sequence:CCGGTCATTGGGAGGAGACTAAATTCTCGAGAATTTAGTCTCCTCCCAATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177898.4-1682s21c1
Sequence:CCGGCAGTAAAGGAGAAACCGTAATCTCGAGATTACGGTTTCTCCTTTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177898
NEK5 MISSION shRNA shRNA Plasmid DNA
NIMA-related kinase 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177898.3-945s1c1
Sequence:CCGGCCACAGCTTGTTGGAGAGTTACTCGAGTAACTCTCCAACAAGCTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177898.3-1430s1c1
Sequence:CCGGCCAGAAGCAGAGGGTTTCTTTCTCGAGAAAGAAACCCTCTGCTTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177898.3-767s1c1
Sequence:CCGGCGTGACCTACAGTCCTTGATACTCGAGTATCAAGGACTGTAGGTCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177898.3-218s1c1
Sequence:CCGGGCCTCAAAGAACGAAGTGATTCTCGAGAATCACTTCGTTCTTTGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177898.3-1683s1c1
Sequence:CCGGCCAGTAAAGGAGAAACCGTAACTCGAGTTACGGTTTCTCCTTTACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177898.4-415s21c1
Sequence:CCGGCTCTAGGACTGAAGCATATTCCTCGAGGAATATGCTTCAGTCCTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177898.4-1499s21c1
Sequence:CCGGTCACACTCTGCTGCGAATAATCTCGAGATTATTCGCAGCAGAGTGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177898.4-1094s21c1
Sequence:CCGGTCATTGGGAGGAGACTAAATTCTCGAGAATTTAGTCTCCTCCCAATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177898.4-1682s21c1
Sequence:CCGGCAGTAAAGGAGAAACCGTAATCTCGAGATTACGGTTTCTCCTTTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177898
NEK5 MISSION shRNA Lentiviral Transduction Particles
NIMA-related kinase 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177898.3-945s1c1
Sequence:CCGGCCACAGCTTGTTGGAGAGTTACTCGAGTAACTCTCCAACAAGCTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177898.3-1430s1c1
Sequence:CCGGCCAGAAGCAGAGGGTTTCTTTCTCGAGAAAGAAACCCTCTGCTTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177898.3-767s1c1
Sequence:CCGGCGTGACCTACAGTCCTTGATACTCGAGTATCAAGGACTGTAGGTCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177898.3-218s1c1
Sequence:CCGGGCCTCAAAGAACGAAGTGATTCTCGAGAATCACTTCGTTCTTTGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177898.3-1683s1c1
Sequence:CCGGCCAGTAAAGGAGAAACCGTAACTCGAGTTACGGTTTCTCCTTTACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177898.4-415s21c1
Sequence:CCGGCTCTAGGACTGAAGCATATTCCTCGAGGAATATGCTTCAGTCCTAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177898.4-1499s21c1
Sequence:CCGGTCACACTCTGCTGCGAATAATCTCGAGATTATTCGCAGCAGAGTGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177898.4-1094s21c1
Sequence:CCGGTCATTGGGAGGAGACTAAATTCTCGAGAATTTAGTCTCCTCCCAATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177898.4-1682s21c1
Sequence:CCGGCAGTAAAGGAGAAACCGTAATCTCGAGATTACGGTTTCTCCTTTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_292160
NEK5 MISSION shRNA Bacterial Glycerol Stock
NIMA-related kinase 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292160.5-1069s1c1
Sequence:CCGGGCCCACCAAGATCAAGGATATCTCGAGATATCCTTGATCTTGGTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292160.5-1471s1c1
Sequence:CCGGGTAATGGAGAAGAGCCTAGATCTCGAGATCTAGGCTCTTCTCCATTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_292160.5-2750s1c1
Sequence:CCGGGCTGCCTTCAAGCATCTGTTTCTCGAGAAACAGATGCTTGAAGGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292160.5-1562s1c1
Sequence:CCGGCCAACAGTACCACAATGACATCTCGAGATGTCATTGTGGTACTGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292160.5-333s1c1
Sequence:CCGGGCCTTCTTCAATTCATTTCAACTCGAGTTGAAATGAATTGAAGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_292160
NEK5 MISSION shRNA shRNA Plasmid DNA
NIMA-related kinase 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292160.5-1069s1c1
Sequence:CCGGGCCCACCAAGATCAAGGATATCTCGAGATATCCTTGATCTTGGTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292160.5-1471s1c1
Sequence:CCGGGTAATGGAGAAGAGCCTAGATCTCGAGATCTAGGCTCTTCTCCATTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_292160.5-2750s1c1
Sequence:CCGGGCTGCCTTCAAGCATCTGTTTCTCGAGAAACAGATGCTTGAAGGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292160.5-1562s1c1
Sequence:CCGGCCAACAGTACCACAATGACATCTCGAGATGTCATTGTGGTACTGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292160.5-333s1c1
Sequence:CCGGGCCTTCTTCAATTCATTTCAACTCGAGTTGAAATGAATTGAAGAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_292160
NEK5 MISSION shRNA Lentiviral Transduction Particles
NIMA-related kinase 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292160.5-1069s1c1
Sequence:CCGGGCCCACCAAGATCAAGGATATCTCGAGATATCCTTGATCTTGGTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292160.5-1471s1c1
Sequence:CCGGGTAATGGAGAAGAGCCTAGATCTCGAGATCTAGGCTCTTCTCCATTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_292160.5-2750s1c1
Sequence:CCGGGCTGCCTTCAAGCATCTGTTTCTCGAGAAACAGATGCTTGAAGGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292160.5-1562s1c1
Sequence:CCGGCCAACAGTACCACAATGACATCTCGAGATGTCATTGTGGTACTGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292160.5-333s1c1
Sequence:CCGGGCCTTCTTCAATTCATTTCAACTCGAGTTGAAATGAATTGAAGAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)