EMAIL THIS PAGE TO A FRIEND

NEK7

NIMA-related kinase 7

73 Gene Product Result for
UniProtKB ID: Q8TDX7, A6NGT8
Gene ID:
Human(140609) Summary: NIMA-related kinases share high amino acid sequence identity with the gene product of the Aspergillus nidulans 'never in mitosis A' gene, which controls initiation of mitosis.[supplied by OMIM, Jul 2002]
Mouse(59125) NIMA (never in mitosis gene a)-related expressed kinase 7
Rat(360850) NIMA-related kinase 7
Thale Cress(820397) serine/threonine-protein kinase Nek7
cow(781355) NIMA-related kinase 7
Horse(100061722) NIMA (never in mitosis gene a)-related kinase 7
domestic cat(101093327) NIMA (never in mitosis gene a)-related kinase 7
dog(480008) NIMA (never in mitosis gene a)-related kinase 7
Zebrafish(445223) NIMA (never in mitosis gene a)-related kinase 7
chicken(424350) NIMA (never in mitosis gene a)-related kinase 7
domestic guinea pig(101789054) NIMA-related kinase 7
naked mole-rat(101708026) NIMA-related kinase 7
sheep(101102161) NIMA-related kinase 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
N7663 Anti-NEK7 (16-30) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2501398 Anti-NEK7 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution bovine, human, rat, canine, mouse
ELISA, western blot pricing
SAB2501397 Anti-NEK7 antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, mouse, bovine, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB1408342 Anti-NEK7 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA015520 Anti-NEK7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
AV48999 Anti-NEK7 antibody produced in rabbit affinity isolated antibody dog, bovine, horse, mouse, rat, human, guinea pig
western blot pricing
HPA018193 Anti-NEK7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4500475 Anti-NEK7 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB2106831 Anti-NEK7 antibody produced in rabbit affinity isolated antibody human, rabbit, mouse, horse, guinea pig, rat, bovine, dog
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021605 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021605 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021605 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_133494 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133494 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133494 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133494 siRNAs that have been validated in the lab human pricing
NM_001108346 Rosetta Predictions rat pricing
NM_021605 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133494 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196981 validated 474
1 SASI_Hs01_00196982 validated 808
1 SASI_Hs01_00196983 validated 339
2 SASI_Hs01_00196984 predicted 485
3 SASI_Hs01_00196985 predicted 634
4 SASI_Hs01_00196986 predicted 770
5 SASI_Hs01_00196987 predicted 235
6 SASI_Hs01_00196989 predicted 208
7 SASI_Hs02_00363221 predicted 205
8 SASI_Hs01_00196990 predicted 514
9 SASI_Hs02_00363222 predicted 696
10 SASI_Hs01_00196988 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108346 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237759 predicted 347
2 SASI_Rn02_00237760 predicted 289
3 SASI_Rn02_00237761 predicted 691
4 SASI_Rn02_00237762 predicted 824
5 SASI_Rn02_00237763 predicted 1077
6 SASI_Rn02_00237764 predicted 587
7 SASI_Rn02_00237765 predicted 299
8 SASI_Rn02_00237766 predicted 505
9 SASI_Rn02_00237767 predicted 415
10 SASI_Rn02_00237768 predicted 1209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021605 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326362 predicted 464
2 SASI_Mm02_00326363 predicted 432
3 SASI_Mm02_00326364 predicted 387
4 SASI_Mm02_00326365 predicted 765
5 SASI_Mm02_00326366 predicted 295
6 SASI_Mm02_00326367 predicted 239
7 SASI_Mm02_00326368 predicted 245
8 SASI_Mm02_00326369 predicted 390
9 SASI_Mm02_00326370 predicted 364
10 SASI_Mm02_00326371 predicted 450
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021605
VALIDATED
NEK7 MISSION shRNA Bacterial Glycerol Stock
NIMA-related kinase 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021605.2-237s1c1
Sequence:CCGGCGGCCAGATATGGGCTATAATCTCGAGATTATAGCCCATATCTGGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021605.2-294s1c1
Sequence:CCGGCGTGGACAATTTAGTGAAGTTCTCGAGAACTTCACTAAATTGTCCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021605.2-633s1c1
Sequence:CCGGCGAAGAGTCATGCACAGAGATCTCGAGATCTCTGTGCATGACTCTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021605.2-881s1c1
Sequence:CCGGCGGCGACAAGATGAACTTGTACTCGAGTACAAGTTCATCTTGTCGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021605.3-237s21c1
Sequence:CCGGACGGCCAGATATGGGCTATAACTCGAGTTATAGCCCATATCTGGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021605.2-465s1c1
Sequence:CCGGGCATCATTCATTGAGGATAATCTCGAGATTATCCTCAATGAATGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021605.3-1017s21c1
Sequence:CCGGACCCGACATCGCCTATGTTTACTCGAGTAAACATAGGCGATGTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021605.3-339s21c1
Sequence:CCGGTGGAGTGCCGGTAGCGTTAAACTCGAGTTTAACGCTACCGGCACTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021605.3-967s21c1
Sequence:CCGGGAGCTACGACAGCTAGTTAATCTCGAGATTAACTAGCTGTCGTAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236008    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021605.3-1918s21c1
Sequence:CCGGCACTGTAATGCAAGCATATATCTCGAGATATATGCTTGCATTACAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021605
VALIDATED
NEK7 MISSION shRNA shRNA Plasmid DNA
NIMA-related kinase 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021605.2-237s1c1
Sequence:CCGGCGGCCAGATATGGGCTATAATCTCGAGATTATAGCCCATATCTGGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021605.2-294s1c1
Sequence:CCGGCGTGGACAATTTAGTGAAGTTCTCGAGAACTTCACTAAATTGTCCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021605.2-633s1c1
Sequence:CCGGCGAAGAGTCATGCACAGAGATCTCGAGATCTCTGTGCATGACTCTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021605.2-881s1c1
Sequence:CCGGCGGCGACAAGATGAACTTGTACTCGAGTACAAGTTCATCTTGTCGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021605.3-237s21c1
Sequence:CCGGACGGCCAGATATGGGCTATAACTCGAGTTATAGCCCATATCTGGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021605.2-465s1c1
Sequence:CCGGGCATCATTCATTGAGGATAATCTCGAGATTATCCTCAATGAATGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021605.3-1017s21c1
Sequence:CCGGACCCGACATCGCCTATGTTTACTCGAGTAAACATAGGCGATGTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021605.3-339s21c1
Sequence:CCGGTGGAGTGCCGGTAGCGTTAAACTCGAGTTTAACGCTACCGGCACTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021605.3-967s21c1
Sequence:CCGGGAGCTACGACAGCTAGTTAATCTCGAGATTAACTAGCTGTCGTAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236008    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021605.3-1918s21c1
Sequence:CCGGCACTGTAATGCAAGCATATATCTCGAGATATATGCTTGCATTACAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021605
VALIDATED
NEK7 MISSION shRNA Lentiviral Transduction Particles
NIMA-related kinase 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021605.2-237s1c1
Sequence:CCGGCGGCCAGATATGGGCTATAATCTCGAGATTATAGCCCATATCTGGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021605.2-294s1c1
Sequence:CCGGCGTGGACAATTTAGTGAAGTTCTCGAGAACTTCACTAAATTGTCCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021605.2-633s1c1
Sequence:CCGGCGAAGAGTCATGCACAGAGATCTCGAGATCTCTGTGCATGACTCTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021605.2-881s1c1
Sequence:CCGGCGGCGACAAGATGAACTTGTACTCGAGTACAAGTTCATCTTGTCGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021605.3-237s21c1
Sequence:CCGGACGGCCAGATATGGGCTATAACTCGAGTTATAGCCCATATCTGGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021605.2-465s1c1
Sequence:CCGGGCATCATTCATTGAGGATAATCTCGAGATTATCCTCAATGAATGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021605.3-1017s21c1
Sequence:CCGGACCCGACATCGCCTATGTTTACTCGAGTAAACATAGGCGATGTCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021605.3-339s21c1
Sequence:CCGGTGGAGTGCCGGTAGCGTTAAACTCGAGTTTAACGCTACCGGCACTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021605.3-967s21c1
Sequence:CCGGGAGCTACGACAGCTAGTTAATCTCGAGATTAACTAGCTGTCGTAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236008    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021605.3-1918s21c1
Sequence:CCGGCACTGTAATGCAAGCATATATCTCGAGATATATGCTTGCATTACAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133494
VALIDATED
NEK7 MISSION shRNA Bacterial Glycerol Stock
NIMA-related kinase 7
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133494.1-113s1c1
Sequence:CCGGCGACCGGATATGGGCTATAATCTCGAGATTATAGCCCATATCCGGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133494.1-270s1c1
Sequence:CCGGCACGTGCTGATTGCATCAAAGCTCGAGCTTTGATGCAATCAGCACGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133494.x-732s1c1
Sequence:CCGGTGGCTGCATTACAAAGTCCTTCTCGAGAAGGACTTTGTAATGCAGCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133494.x-171s1c1
Sequence:CCGGGCGGACAATTTAGTGAAGTTTCTCGAGAAACTTCACTAAATTGTCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133494.x-630s1c1
Sequence:CCGGCTTTAGTTGGTACGCCTTATTCTCGAGAATAAGGCGTACCAACTAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133494.x-824s1c1
Sequence:CCGGTCAGATCACTATTCAGAAGAACTCGAGTTCTTCTGAATAGTGATCTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001969    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133494.x-970s1c1
Sequence:CCGGGAAGAGTGTAACCAAAGTAATCTCGAGATTACTTTGGTTACACTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133494.1-903s1c1
Sequence:CCGGCCTATGTTTATGACGTAGCAACTCGAGTTGCTACGTCATAAACATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133494.1-536s1c1
Sequence:CCGGCCAGCTAATGTGTTCATTACACTCGAGTGTAATGAACACATTAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133494.1-722s1c1
Sequence:CCGGCTATATGAGATGGCTGCATTACTCGAGTAATGCAGCCATCTCATATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133494.1-615s1c1
Sequence:CCGGCCACAGCTGCACATTCTTTAGCTCGAGCTAAAGAATGTGCAGCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133494.1-513s1c1
Sequence:CCGGGAGTCATGCATAGAGATATAACTCGAGTTATATCTCTATGCATGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133494
VALIDATED
NEK7 MISSION shRNA shRNA Plasmid DNA
NIMA-related kinase 7
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133494.1-113s1c1
Sequence:CCGGCGACCGGATATGGGCTATAATCTCGAGATTATAGCCCATATCCGGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133494.1-270s1c1
Sequence:CCGGCACGTGCTGATTGCATCAAAGCTCGAGCTTTGATGCAATCAGCACGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133494.x-732s1c1
Sequence:CCGGTGGCTGCATTACAAAGTCCTTCTCGAGAAGGACTTTGTAATGCAGCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133494.x-171s1c1
Sequence:CCGGGCGGACAATTTAGTGAAGTTTCTCGAGAAACTTCACTAAATTGTCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133494.x-630s1c1
Sequence:CCGGCTTTAGTTGGTACGCCTTATTCTCGAGAATAAGGCGTACCAACTAAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133494.x-824s1c1
Sequence:CCGGTCAGATCACTATTCAGAAGAACTCGAGTTCTTCTGAATAGTGATCTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001969    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133494.x-970s1c1
Sequence:CCGGGAAGAGTGTAACCAAAGTAATCTCGAGATTACTTTGGTTACACTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133494.1-903s1c1
Sequence:CCGGCCTATGTTTATGACGTAGCAACTCGAGTTGCTACGTCATAAACATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133494.1-536s1c1
Sequence:CCGGCCAGCTAATGTGTTCATTACACTCGAGTGTAATGAACACATTAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133494.1-722s1c1
Sequence:CCGGCTATATGAGATGGCTGCATTACTCGAGTAATGCAGCCATCTCATATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133494.1-615s1c1
Sequence:CCGGCCACAGCTGCACATTCTTTAGCTCGAGCTAAAGAATGTGCAGCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133494.1-513s1c1
Sequence:CCGGGAGTCATGCATAGAGATATAACTCGAGTTATATCTCTATGCATGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133494
VALIDATED
NEK7 MISSION shRNA Lentiviral Transduction Particles
NIMA-related kinase 7
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133494.1-113s1c1
Sequence:CCGGCGACCGGATATGGGCTATAATCTCGAGATTATAGCCCATATCCGGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133494.1-270s1c1
Sequence:CCGGCACGTGCTGATTGCATCAAAGCTCGAGCTTTGATGCAATCAGCACGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133494.x-732s1c1
Sequence:CCGGTGGCTGCATTACAAAGTCCTTCTCGAGAAGGACTTTGTAATGCAGCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133494.x-171s1c1
Sequence:CCGGGCGGACAATTTAGTGAAGTTTCTCGAGAAACTTCACTAAATTGTCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133494.x-630s1c1
Sequence:CCGGCTTTAGTTGGTACGCCTTATTCTCGAGAATAAGGCGTACCAACTAAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133494.x-824s1c1
Sequence:CCGGTCAGATCACTATTCAGAAGAACTCGAGTTCTTCTGAATAGTGATCTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001969    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133494.x-970s1c1
Sequence:CCGGGAAGAGTGTAACCAAAGTAATCTCGAGATTACTTTGGTTACACTCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133494.1-903s1c1
Sequence:CCGGCCTATGTTTATGACGTAGCAACTCGAGTTGCTACGTCATAAACATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133494.1-536s1c1
Sequence:CCGGCCAGCTAATGTGTTCATTACACTCGAGTGTAATGAACACATTAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133494.1-722s1c1
Sequence:CCGGCTATATGAGATGGCTGCATTACTCGAGTAATGCAGCCATCTCATATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_133494.1-615s1c1
Sequence:CCGGCCACAGCTGCACATTCTTTAGCTCGAGCTAAAGAATGTGCAGCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133494.1-513s1c1
Sequence:CCGGGAGTCATGCATAGAGATATAACTCGAGTTATATCTCTATGCATGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)