EMAIL THIS PAGE TO A FRIEND

NEK8

NIMA-related kinase 8

73 Gene Product Result for
Synonyms: JCK NEK12A NPHP9
UniProtKB ID: Q86SG6, A6NIC5, Q14CL7, Q2M1S6, Q8NDH1
Gene ID:
Human(284086) Summary: This gene encodes a member of the serine/threionine protein kinase family related to NIMA (never in mitosis, gene A) of Aspergillus nidulans. The encoded protein may play a role in cell cycle progression from G2 to M phase. Mutations in the related mouse gene are associated with a disease phenotype that closely parallels the juvenile autosomal recessive form of polycystic kidney disease in humans. [provided by RefSeq, Jul 2008]
Mouse(140859) NIMA (never in mitosis gene a)-related expressed kinase 8
Rat(287473) NIMA-related kinase 8
sheep(101107205) NIMA-related kinase 8
naked mole-rat(101715978) NIMA-related kinase 8
Domestic Rabbit(100345106) NIMA (never in mitosis gene a)- related kinase 8
domestic guinea pig(100723452) NIMA-related kinase 8
Zebrafish(171094) NIMA (never in mitosis gene a)-related kinase 8
domestic cat(101084837) NIMA (never in mitosis gene a)- related kinase 8
cow(532332) NIMA (never in mitosis gene a)- related kinase 8
Horse(100059451) NIMA (never in mitosis gene a)- related kinase 8
dog(491171) NIMA (never in mitosis gene a)- related kinase 8
chicken(417576) NIMA (never in mitosis gene a)- related kinase 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080849 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080849 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080849 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178170 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178170 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178170 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178170 Rosetta Predictions human pricing
NM_001105804 Rosetta Predictions rat pricing
NM_080849 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061251 predicted 535
2 SASI_Hs01_00061252 predicted 2102
3 SASI_Hs01_00061254 predicted 652
4 SASI_Hs02_00369582 predicted 2106
5 SASI_Hs01_00061255 predicted 1828
6 SASI_Hs01_00061256 predicted 1489
7 SASI_Hs01_00061257 predicted 1991
8 SASI_Hs01_00061258 predicted 443
9 SASI_Hs01_00061260 predicted 640
10 SASI_Hs02_00369583 predicted 1808
11 SASI_Hs01_00061253 predicted 197
12 SASI_Hs01_00061259 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105804 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212696 predicted 1828
2 SASI_Rn02_00212697 predicted 586
3 SASI_Rn02_00212698 predicted 2152
4 SASI_Rn02_00212699 predicted 1638
5 SASI_Rn02_00212700 predicted 1565
6 SASI_Rn02_00212701 predicted 1277
7 SASI_Rn02_00212702 predicted 1631
8 SASI_Rn02_00212703 predicted 502
9 SASI_Rn02_00212704 predicted 287
10 SASI_Rn02_00212705 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080849 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178289 predicted 592
2 SASI_Mm01_00178290 predicted 253
3 SASI_Mm01_00178291 predicted 1566
4 SASI_Mm01_00178292 predicted 448
5 SASI_Mm01_00178293 predicted 447
6 SASI_Mm01_00178294 predicted 1567
7 SASI_Mm01_00178295 predicted 449
8 SASI_Mm01_00178296 predicted 1582
9 SASI_Mm01_00178297 predicted 906
10 SASI_Mm02_00338222 predicted 1636
11 SASI_Mm01_00178298 predicted 2068
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080849
VALIDATED
NEK8 MISSION shRNA Bacterial Glycerol Stock
NIMA-related kinase 8
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080849.3-1452s21c1
Sequence:CCGGGTCCACAGATGGAGAGTTATTCTCGAGAATAACTCTCCATCTGTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080849.3-1327s21c1
Sequence:CCGGAGTGGCAGCAATGGGTGTTTACTCGAGTAAACACCCATTGCTGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080849.3-275s21c1
Sequence:CCGGAGGACAAGGCCCTCATGATTGCTCGAGCAATCATGAGGGCCTTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080849.3-1293s21c1
Sequence:CCGGCTTGACAGACCGAGGCATTATCTCGAGATAATGCCTCGGTCTGTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080849.3-242s21c1
Sequence:CCGGCCAACGTCATCGAGTACTATGCTCGAGCATAGTACTCGATGACGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080849.3-2498s21c1
Sequence:CCGGGCTTGTTTGGACTGGTCATTACTCGAGTAATGACCAGTCCAAACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080849.3-368s21c1
Sequence:CCGGAGACGATCCTTCACTTCTTTGCTCGAGCAAAGAAGTGAAGGATCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080849.3-2235s21c1
Sequence:CCGGTCCTGGATTGTGTCGTCAATGCTCGAGCATTGACGACACAATCCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080849.2-1570s1c1
Sequence:CCGGCAGAGAGTTGTCTGTGGTATTCTCGAGAATACCACAGACAACTCTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080849.2-1302s1c1
Sequence:CCGGCCGAGGCATTATCATGACGTTCTCGAGAACGTCATGATAATGCCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080849.2-2055s1c1
Sequence:CCGGGCTGGATGAGACTCATCCTTACTCGAGTAAGGATGAGTCTCATCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080849.2-241s1c1
Sequence:CCGGCCCAACGTCATCGAGTACTATCTCGAGATAGTACTCGATGACGTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080849.2-462s1c1
Sequence:CCGGCCTTCTTGACAAACACCGCATCTCGAGATGCGGTGTTTGTCAAGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080849
VALIDATED
NEK8 MISSION shRNA shRNA Plasmid DNA
NIMA-related kinase 8
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080849.3-1452s21c1
Sequence:CCGGGTCCACAGATGGAGAGTTATTCTCGAGAATAACTCTCCATCTGTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080849.3-1327s21c1
Sequence:CCGGAGTGGCAGCAATGGGTGTTTACTCGAGTAAACACCCATTGCTGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080849.3-275s21c1
Sequence:CCGGAGGACAAGGCCCTCATGATTGCTCGAGCAATCATGAGGGCCTTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080849.3-1293s21c1
Sequence:CCGGCTTGACAGACCGAGGCATTATCTCGAGATAATGCCTCGGTCTGTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080849.3-242s21c1
Sequence:CCGGCCAACGTCATCGAGTACTATGCTCGAGCATAGTACTCGATGACGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080849.3-2498s21c1
Sequence:CCGGGCTTGTTTGGACTGGTCATTACTCGAGTAATGACCAGTCCAAACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080849.3-368s21c1
Sequence:CCGGAGACGATCCTTCACTTCTTTGCTCGAGCAAAGAAGTGAAGGATCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080849.3-2235s21c1
Sequence:CCGGTCCTGGATTGTGTCGTCAATGCTCGAGCATTGACGACACAATCCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080849.2-1570s1c1
Sequence:CCGGCAGAGAGTTGTCTGTGGTATTCTCGAGAATACCACAGACAACTCTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080849.2-1302s1c1
Sequence:CCGGCCGAGGCATTATCATGACGTTCTCGAGAACGTCATGATAATGCCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080849.2-2055s1c1
Sequence:CCGGGCTGGATGAGACTCATCCTTACTCGAGTAAGGATGAGTCTCATCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080849.2-241s1c1
Sequence:CCGGCCCAACGTCATCGAGTACTATCTCGAGATAGTACTCGATGACGTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080849.2-462s1c1
Sequence:CCGGCCTTCTTGACAAACACCGCATCTCGAGATGCGGTGTTTGTCAAGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080849
VALIDATED
NEK8 MISSION shRNA Lentiviral Transduction Particles
NIMA-related kinase 8
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080849.3-1452s21c1
Sequence:CCGGGTCCACAGATGGAGAGTTATTCTCGAGAATAACTCTCCATCTGTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080849.3-1327s21c1
Sequence:CCGGAGTGGCAGCAATGGGTGTTTACTCGAGTAAACACCCATTGCTGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080849.3-275s21c1
Sequence:CCGGAGGACAAGGCCCTCATGATTGCTCGAGCAATCATGAGGGCCTTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080849.3-1293s21c1
Sequence:CCGGCTTGACAGACCGAGGCATTATCTCGAGATAATGCCTCGGTCTGTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080849.3-242s21c1
Sequence:CCGGCCAACGTCATCGAGTACTATGCTCGAGCATAGTACTCGATGACGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080849.3-2498s21c1
Sequence:CCGGGCTTGTTTGGACTGGTCATTACTCGAGTAATGACCAGTCCAAACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080849.3-368s21c1
Sequence:CCGGAGACGATCCTTCACTTCTTTGCTCGAGCAAAGAAGTGAAGGATCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080849.3-2235s21c1
Sequence:CCGGTCCTGGATTGTGTCGTCAATGCTCGAGCATTGACGACACAATCCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080849.2-1570s1c1
Sequence:CCGGCAGAGAGTTGTCTGTGGTATTCTCGAGAATACCACAGACAACTCTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080849.2-1302s1c1
Sequence:CCGGCCGAGGCATTATCATGACGTTCTCGAGAACGTCATGATAATGCCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080849.2-2055s1c1
Sequence:CCGGGCTGGATGAGACTCATCCTTACTCGAGTAAGGATGAGTCTCATCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080849.2-241s1c1
Sequence:CCGGCCCAACGTCATCGAGTACTATCTCGAGATAGTACTCGATGACGTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080849.2-462s1c1
Sequence:CCGGCCTTCTTGACAAACACCGCATCTCGAGATGCGGTGTTTGTCAAGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178170
NEK8 MISSION shRNA Bacterial Glycerol Stock
NIMA-related kinase 8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178170.2-2231s1c1
Sequence:CCGGCCTTGGATATGGAAACCTCAACTCGAGTTGAGGTTTCCATATCCAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178170.2-210s1c1
Sequence:CCGGCCTGGAAGACAAAGCCCTTATCTCGAGATAAGGGCTTTGTCTTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178170.2-1299s1c1
Sequence:CCGGGCCCACCATTGTGGAGGCTTTCTCGAGAAAGCCTCCACAATGGTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178170.2-1734s1c1
Sequence:CCGGCTCGGGTGATTGCTACACTTTCTCGAGAAAGTGTAGCAATCACCCGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199812    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178170.2-2081s1c1
Sequence:CCGGGCACCCGGATTCACCTCTGGACTCGAGTCCAGAGGTGAATCCGGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199312    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178170.2-2321s1c1
Sequence:CCGGCCAGCCTGGCTAGAGTTAGAACTCGAGTTCTAACTCTAGCCAGGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178170.2-181s1c1
Sequence:CCGGCCCAATGTCATTGAGTACTACCTCGAGGTAGTACTCAATGACATTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178170.2-1494s1c1
Sequence:CCGGGCGAGTTGTATGTGGTATCGACTCGAGTCGATACCACATACAACTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178170
NEK8 MISSION shRNA shRNA Plasmid DNA
NIMA-related kinase 8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178170.2-2231s1c1
Sequence:CCGGCCTTGGATATGGAAACCTCAACTCGAGTTGAGGTTTCCATATCCAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178170.2-210s1c1
Sequence:CCGGCCTGGAAGACAAAGCCCTTATCTCGAGATAAGGGCTTTGTCTTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178170.2-1299s1c1
Sequence:CCGGGCCCACCATTGTGGAGGCTTTCTCGAGAAAGCCTCCACAATGGTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178170.2-1734s1c1
Sequence:CCGGCTCGGGTGATTGCTACACTTTCTCGAGAAAGTGTAGCAATCACCCGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199812    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178170.2-2081s1c1
Sequence:CCGGGCACCCGGATTCACCTCTGGACTCGAGTCCAGAGGTGAATCCGGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199312    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178170.2-2321s1c1
Sequence:CCGGCCAGCCTGGCTAGAGTTAGAACTCGAGTTCTAACTCTAGCCAGGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178170.2-181s1c1
Sequence:CCGGCCCAATGTCATTGAGTACTACCTCGAGGTAGTACTCAATGACATTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178170.2-1494s1c1
Sequence:CCGGGCGAGTTGTATGTGGTATCGACTCGAGTCGATACCACATACAACTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178170
NEK8 MISSION shRNA Lentiviral Transduction Particles
NIMA-related kinase 8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178170.2-2231s1c1
Sequence:CCGGCCTTGGATATGGAAACCTCAACTCGAGTTGAGGTTTCCATATCCAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178170.2-210s1c1
Sequence:CCGGCCTGGAAGACAAAGCCCTTATCTCGAGATAAGGGCTTTGTCTTCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178170.2-1299s1c1
Sequence:CCGGGCCCACCATTGTGGAGGCTTTCTCGAGAAAGCCTCCACAATGGTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178170.2-1734s1c1
Sequence:CCGGCTCGGGTGATTGCTACACTTTCTCGAGAAAGTGTAGCAATCACCCGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199812    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178170.2-2081s1c1
Sequence:CCGGGCACCCGGATTCACCTCTGGACTCGAGTCCAGAGGTGAATCCGGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199312    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178170.2-2321s1c1
Sequence:CCGGCCAGCCTGGCTAGAGTTAGAACTCGAGTTCTAACTCTAGCCAGGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178170.2-181s1c1
Sequence:CCGGCCCAATGTCATTGAGTACTACCTCGAGGTAGTACTCAATGACATTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178170.2-1494s1c1
Sequence:CCGGGCGAGTTGTATGTGGTATCGACTCGAGTCGATACCACATACAACTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)