EMAIL THIS PAGE TO A FRIEND

NEK9

NIMA-related kinase 9

108 Gene Product Result for
Synonyms: NERCC NERCC1 Nek8
Gene ID:
Mouse(217718) NIMA (never in mitosis gene a)-related expressed kinase 9
Rat(299204) NIMA-related kinase 9
chicken(428891) NIMA (never in mitosis gene a)- related kinase 9
cow(534652) NIMA (never in mitosis gene a)- related kinase 9
Horse(100057328) NIMA (never in mitosis gene a)- related kinase 9
dog(490790) NIMA (never in mitosis gene a)- related kinase 9
domestic cat(101083774) NIMA (never in mitosis gene a)- related kinase 9
domestic guinea pig(100713019) NIMA-related kinase 9
naked mole-rat(101719779) NIMA-related kinase 9
sheep(101107968) NIMA-related kinase 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145138 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145138 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145138 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033116 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033116 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033116 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033116 siRNAs that have been validated in the lab human pricing
NM_001106747 Rosetta Predictions rat pricing
NM_145138 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033116 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097839 validated 1006
1 SASI_Hs01_00097840 validated 619
1 SASI_Hs01_00097838 validated 2725
2 SASI_Hs01_00097841 predicted 503
3 SASI_Hs02_00360838 predicted 732
4 SASI_Hs01_00097843 predicted 1492
5 SASI_Hs01_00097844 predicted 2943
6 SASI_Hs01_00097845 predicted 1174
7 SASI_Hs01_00097847 predicted 2191
8 SASI_Hs02_00360839 predicted 779
9 SASI_Hs02_00360840 predicted 1190
10 SASI_Hs01_00097842 predicted 432
11 SASI_Hs01_00097846 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106747 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221998 predicted 1622
2 SASI_Rn02_00221999 predicted 1860
3 SASI_Rn02_00222000 predicted 803
4 SASI_Rn02_00222001 predicted 1157
5 SASI_Rn02_00222002 predicted 640
6 SASI_Rn02_00222003 predicted 2698
7 SASI_Rn02_00222004 predicted 504
8 SASI_Rn02_00222005 predicted 1303
9 SASI_Rn02_00222006 predicted 1467
10 SASI_Rn02_00222007 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145138 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162627 predicted 1327
2 SASI_Mm02_00340535 predicted 3129
3 SASI_Mm01_00162628 predicted 718
4 SASI_Mm01_00162629 predicted 939
5 SASI_Mm01_00162630 predicted 1302
6 SASI_Mm01_00162632 predicted 643
7 SASI_Mm01_00162633 predicted 728
8 SASI_Mm01_00162634 predicted 562
9 SASI_Mm01_00162635 predicted 3141
10 SASI_Mm01_00162636 predicted 611
11 SASI_Mm01_00162631 predicted 1880
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145138
VALIDATED
NEK9 MISSION shRNA Bacterial Glycerol Stock
NIMA-related kinase 9
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145138.1-624s1c1
Sequence:CCGGGCTGGAATCCTCCATAGAGATCTCGAGATCTCTATGGAGGATTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145138.1-2844s1c1
Sequence:CCGGCTGGTGTTAAAGTGTCTGGAACTCGAGTTCCAGACACTTTAACACCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145138.1-2191s1c1
Sequence:CCGGGCTCTGATATCTGTACCTCATCTCGAGATGAGGTACAGATATCAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145138.2-465s21c1
Sequence:CCGGCGACAACATCATTGCCTACTACTCGAGTAGTAGGCAATGATGTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145138.1-1707s1c1
Sequence:CCGGGCCTTAATCATTGTTGCAGTTCTCGAGAACTGCAACAATGATTAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145138.1-440s1c1
Sequence:CCGGCGACAACATCATTGCCTACTACTCGAGTAGTAGGCAATGATGTTGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145138.2-2216s21c1
Sequence:CCGGGCTCTGATATCTGTACCTCATCTCGAGATGAGGTACAGATATCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145138.2-1732s21c1
Sequence:CCGGGCCTTAATCATTGTTGCAGTTCTCGAGAACTGCAACAATGATTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145138.2-649s21c1
Sequence:CCGGGCTGGAATCCTCCATAGAGATCTCGAGATCTCTATGGAGGATTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145138
VALIDATED
NEK9 MISSION shRNA shRNA Plasmid DNA
NIMA-related kinase 9
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145138.1-624s1c1
Sequence:CCGGGCTGGAATCCTCCATAGAGATCTCGAGATCTCTATGGAGGATTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145138.1-2844s1c1
Sequence:CCGGCTGGTGTTAAAGTGTCTGGAACTCGAGTTCCAGACACTTTAACACCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145138.1-2191s1c1
Sequence:CCGGGCTCTGATATCTGTACCTCATCTCGAGATGAGGTACAGATATCAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145138.2-465s21c1
Sequence:CCGGCGACAACATCATTGCCTACTACTCGAGTAGTAGGCAATGATGTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145138.1-1707s1c1
Sequence:CCGGGCCTTAATCATTGTTGCAGTTCTCGAGAACTGCAACAATGATTAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145138.1-440s1c1
Sequence:CCGGCGACAACATCATTGCCTACTACTCGAGTAGTAGGCAATGATGTTGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145138.2-2216s21c1
Sequence:CCGGGCTCTGATATCTGTACCTCATCTCGAGATGAGGTACAGATATCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145138.2-1732s21c1
Sequence:CCGGGCCTTAATCATTGTTGCAGTTCTCGAGAACTGCAACAATGATTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145138.2-649s21c1
Sequence:CCGGGCTGGAATCCTCCATAGAGATCTCGAGATCTCTATGGAGGATTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145138
VALIDATED
NEK9 MISSION shRNA Lentiviral Transduction Particles
NIMA-related kinase 9
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145138.1-624s1c1
Sequence:CCGGGCTGGAATCCTCCATAGAGATCTCGAGATCTCTATGGAGGATTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145138.1-2844s1c1
Sequence:CCGGCTGGTGTTAAAGTGTCTGGAACTCGAGTTCCAGACACTTTAACACCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145138.1-2191s1c1
Sequence:CCGGGCTCTGATATCTGTACCTCATCTCGAGATGAGGTACAGATATCAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145138.2-465s21c1
Sequence:CCGGCGACAACATCATTGCCTACTACTCGAGTAGTAGGCAATGATGTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145138.1-1707s1c1
Sequence:CCGGGCCTTAATCATTGTTGCAGTTCTCGAGAACTGCAACAATGATTAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145138.1-440s1c1
Sequence:CCGGCGACAACATCATTGCCTACTACTCGAGTAGTAGGCAATGATGTTGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145138.2-2216s21c1
Sequence:CCGGGCTCTGATATCTGTACCTCATCTCGAGATGAGGTACAGATATCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145138.2-1732s21c1
Sequence:CCGGGCCTTAATCATTGTTGCAGTTCTCGAGAACTGCAACAATGATTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145138.2-649s21c1
Sequence:CCGGGCTGGAATCCTCCATAGAGATCTCGAGATCTCTATGGAGGATTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033116
VALIDATED
NEK9 MISSION shRNA Bacterial Glycerol Stock
NIMA-related kinase 9
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000226434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033116.3-2993s21c1
Sequence:CCGGAGAACTTCACAGCACACTTACCTCGAGGTAAGTGTGCTGTGAAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033116.x-3094s1c1
Sequence:CCGGGTACATTTGGAGAGTGGCATTCTCGAGAATGCCACTCTCCAAATGTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033116.x-2843s1c1
Sequence:CCGGCCAAAGGAACTCAGACAGCAACTCGAGTTGCTGTCTGAGTTCCTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033116.x-2367s1c1
Sequence:CCGGCCGAGGAATGGAAGGTTTAATCTCGAGATTAAACCTTCCATTCCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033116.x-1603s1c1
Sequence:CCGGGCCTTGATTATTGTTGCAGTTCTCGAGAACTGCAACAATAATCAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033116.x-793s1c1
Sequence:CCGGGTGAAGATCGTGCAAGGAATTCTCGAGAATTCCTTGCACGATCTTCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033116.3-2006s1c1
Sequence:CCGGCCACTGATGATAATCACATTTCTCGAGAAATGTGATTATCATCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199709    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033116.3-3026s1c1
Sequence:CCGGGCAGCTTTCCTGGCTTTGTTCCTCGAGGAACAAAGCCAGGAAAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033116.3-852s21c1
Sequence:GTACCGGATTGATCCAAATGGTTCATTCCTCGAGGAATGAACCATTTGGATCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033116.3-1712s21c1
Sequence:CCGGATCAGTGCATGTCGGGAATTACTCGAGTAATTCCCGACATGCACTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033116.3-1044s21c1
Sequence:CCGGACGAACCAGTGAAGTCTATATCTCGAGATATAGACTTCACTGGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033116.3-1553s21c1
Sequence:CCGGTGGATTCAGAAGAGGATTATTCTCGAGAATAATCCTCTTCTGAATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033116
VALIDATED
NEK9 MISSION shRNA shRNA Plasmid DNA
NIMA-related kinase 9
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000226434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033116.3-2993s21c1
Sequence:CCGGAGAACTTCACAGCACACTTACCTCGAGGTAAGTGTGCTGTGAAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033116.x-3094s1c1
Sequence:CCGGGTACATTTGGAGAGTGGCATTCTCGAGAATGCCACTCTCCAAATGTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033116.x-2843s1c1
Sequence:CCGGCCAAAGGAACTCAGACAGCAACTCGAGTTGCTGTCTGAGTTCCTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033116.x-2367s1c1
Sequence:CCGGCCGAGGAATGGAAGGTTTAATCTCGAGATTAAACCTTCCATTCCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033116.x-1603s1c1
Sequence:CCGGGCCTTGATTATTGTTGCAGTTCTCGAGAACTGCAACAATAATCAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033116.x-793s1c1
Sequence:CCGGGTGAAGATCGTGCAAGGAATTCTCGAGAATTCCTTGCACGATCTTCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033116.3-2006s1c1
Sequence:CCGGCCACTGATGATAATCACATTTCTCGAGAAATGTGATTATCATCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199709    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033116.3-3026s1c1
Sequence:CCGGGCAGCTTTCCTGGCTTTGTTCCTCGAGGAACAAAGCCAGGAAAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033116.3-852s21c1
Sequence:GTACCGGATTGATCCAAATGGTTCATTCCTCGAGGAATGAACCATTTGGATCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033116.3-1712s21c1
Sequence:CCGGATCAGTGCATGTCGGGAATTACTCGAGTAATTCCCGACATGCACTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033116.3-1044s21c1
Sequence:CCGGACGAACCAGTGAAGTCTATATCTCGAGATATAGACTTCACTGGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033116.3-1553s21c1
Sequence:CCGGTGGATTCAGAAGAGGATTATTCTCGAGAATAATCCTCTTCTGAATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033116
VALIDATED
NEK9 MISSION shRNA Lentiviral Transduction Particles
NIMA-related kinase 9
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000226434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033116.3-2993s21c1
Sequence:CCGGAGAACTTCACAGCACACTTACCTCGAGGTAAGTGTGCTGTGAAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033116.x-3094s1c1
Sequence:CCGGGTACATTTGGAGAGTGGCATTCTCGAGAATGCCACTCTCCAAATGTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033116.x-2843s1c1
Sequence:CCGGCCAAAGGAACTCAGACAGCAACTCGAGTTGCTGTCTGAGTTCCTTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033116.x-2367s1c1
Sequence:CCGGCCGAGGAATGGAAGGTTTAATCTCGAGATTAAACCTTCCATTCCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033116.x-1603s1c1
Sequence:CCGGGCCTTGATTATTGTTGCAGTTCTCGAGAACTGCAACAATAATCAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033116.x-793s1c1
Sequence:CCGGGTGAAGATCGTGCAAGGAATTCTCGAGAATTCCTTGCACGATCTTCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033116.3-2006s1c1
Sequence:CCGGCCACTGATGATAATCACATTTCTCGAGAAATGTGATTATCATCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199709    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033116.3-3026s1c1
Sequence:CCGGGCAGCTTTCCTGGCTTTGTTCCTCGAGGAACAAAGCCAGGAAAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033116.3-852s21c1
Sequence:GTACCGGATTGATCCAAATGGTTCATTCCTCGAGGAATGAACCATTTGGATCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033116.3-1712s21c1
Sequence:CCGGATCAGTGCATGTCGGGAATTACTCGAGTAATTCCCGACATGCACTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033116.3-1044s21c1
Sequence:CCGGACGAACCAGTGAAGTCTATATCTCGAGATATAGACTTCACTGGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033116.3-1553s21c1
Sequence:CCGGTGGATTCAGAAGAGGATTATTCTCGAGAATAATCCTCTTCTGAATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)