EMAIL THIS PAGE TO A FRIEND

NELFA

negative elongation factor complex member A

54 Gene Product Result for
Synonyms: NELF-A WHSC2
UniProtKB ID: Q9H3P2, A2A2T1, O95392
Gene ID:
Human(7469) Summary: This gene is expressed ubiquitously with higher levels in fetal than in adult tissues. It encodes a protein sharing 93% sequence identity with the mouse protein. Wolf-Hirschhorn syndrome (WHS) is a malformation syndrome associated with a hemizygous deletion of the distal short arm of chromosome 4. This gene is mapped to the 165 kb WHS critical region, and may play a role in the phenotype of the WHS or Pitt-Rogers-Danks syndrome. The encoded protein is found to be capable of reacting with HLA-A2-restricted and tumor-specific cytotoxic T lymphocytes, suggesting a target for use in specific immunotherapy for a large number of cancer patients. This protein has also been shown to be a member of the NELF (negative elongation factor) protein complex that participates in the regulation of RNA polymerase II transcription elongation. [provided by RefSeq, Jul 2008]
Mouse(24116) negative elongation factor complex member A, Whsc2
Rat(305455) negative elongation factor complex member A
Zebrafish(559677) negative elongation factor complex member A
naked mole-rat(101708884) negative elongation factor complex member A
domestic guinea pig(100733233) negative elongation factor complex member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005663 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005663 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005663 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011914 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011914 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011914 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005663 Rosetta Predictions human pricing
NM_001008339 Rosetta Predictions rat pricing
NM_011914 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174642 predicted 1323
2 SASI_Hs01_00174643 predicted 321
3 SASI_Hs01_00174644 predicted 1560
4 SASI_Hs01_00174645 predicted 335
5 SASI_Hs01_00174646 predicted 978
6 SASI_Hs01_00174647 predicted 268
7 SASI_Hs01_00174648 predicted 1344
8 SASI_Hs01_00174649 predicted 394
9 SASI_Hs01_00174650 predicted 265
10 SASI_Hs01_00174651 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008339 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091001 predicted 689
2 SASI_Rn01_00091003 predicted 822
3 SASI_Rn01_00091005 predicted 1687
4 SASI_Rn01_00091006 predicted 1320
5 SASI_Rn02_00199088 predicted 971
6 SASI_Rn01_00091007 predicted 919
7 SASI_Rn01_00091008 predicted 1438
8 SASI_Rn01_00091009 predicted 275
9 SASI_Rn01_00091010 predicted 335
10 SASI_Rn02_00199089 predicted 1631
11 SASI_Rn01_00091002 predicted 423
12 SASI_Rn01_00091004 predicted 978
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011914 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321738 predicted 378
2 SASI_Mm01_00053820 predicted 651
3 SASI_Mm01_00053821 predicted 335
4 SASI_Mm01_00053822 predicted 935
5 SASI_Mm01_00053824 predicted 1288
6 SASI_Mm01_00053825 predicted 1316
7 SASI_Mm02_00321739 predicted 235
8 SASI_Mm01_00053826 predicted 634
9 SASI_Mm01_00053827 predicted 917
10 SASI_Mm01_00053828 predicted 222
11 SASI_Mm01_00053823 predicted 300
12 SASI_Mm01_00053829 predicted 886
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005663
NELFA MISSION shRNA Bacterial Glycerol Stock
negative elongation factor complex member A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005663.3-384s21c1
Sequence:CCGGCATCGACAACATCCGTCTCTGCTCGAGCAGAGACGGATGTTGTCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005663.3-1996s21c1
Sequence:CCGGTTTAAGTTCTGGATGCATTTCCTCGAGGAAATGCATCCAGAACTTAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005663.3-1604s21c1
Sequence:CCGGTGTTCAAGACGGCCAACAAAGCTCGAGCTTTGTTGGCCGTCTTGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005663.2-1572s1c1
Sequence:CCGGCACAGTGTTTGAGATGAACTACTCGAGTAGTTCATCTCAAACACTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005663.2-1959s1c1
Sequence:CCGGCCTGTTTGTTAGACTCTTACTCTCGAGAGTAAGAGTCTAACAAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005663.2-1614s1c1
Sequence:CCGGCTTCAAGAAGTACAAGCCCATCTCGAGATGGGCTTGTACTTCTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005663.2-402s1c1
Sequence:CCGGGAATCCCAACGTTCAGGATATCTCGAGATATCCTGAACGTTGGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005663.2-481s1c1
Sequence:CCGGGAGTGCCAGTACTTGAACAAACTCGAGTTTGTTCAAGTACTGGCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005663
NELFA MISSION shRNA shRNA Plasmid DNA
negative elongation factor complex member A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005663.3-384s21c1
Sequence:CCGGCATCGACAACATCCGTCTCTGCTCGAGCAGAGACGGATGTTGTCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005663.3-1996s21c1
Sequence:CCGGTTTAAGTTCTGGATGCATTTCCTCGAGGAAATGCATCCAGAACTTAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005663.3-1604s21c1
Sequence:CCGGTGTTCAAGACGGCCAACAAAGCTCGAGCTTTGTTGGCCGTCTTGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005663.2-1572s1c1
Sequence:CCGGCACAGTGTTTGAGATGAACTACTCGAGTAGTTCATCTCAAACACTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005663.2-1959s1c1
Sequence:CCGGCCTGTTTGTTAGACTCTTACTCTCGAGAGTAAGAGTCTAACAAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005663.2-1614s1c1
Sequence:CCGGCTTCAAGAAGTACAAGCCCATCTCGAGATGGGCTTGTACTTCTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005663.2-402s1c1
Sequence:CCGGGAATCCCAACGTTCAGGATATCTCGAGATATCCTGAACGTTGGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005663.2-481s1c1
Sequence:CCGGGAGTGCCAGTACTTGAACAAACTCGAGTTTGTTCAAGTACTGGCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005663
NELFA MISSION shRNA Lentiviral Transduction Particles
negative elongation factor complex member A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005663.3-384s21c1
Sequence:CCGGCATCGACAACATCCGTCTCTGCTCGAGCAGAGACGGATGTTGTCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005663.3-1996s21c1
Sequence:CCGGTTTAAGTTCTGGATGCATTTCCTCGAGGAAATGCATCCAGAACTTAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005663.3-1604s21c1
Sequence:CCGGTGTTCAAGACGGCCAACAAAGCTCGAGCTTTGTTGGCCGTCTTGAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005663.2-1572s1c1
Sequence:CCGGCACAGTGTTTGAGATGAACTACTCGAGTAGTTCATCTCAAACACTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005663.2-1959s1c1
Sequence:CCGGCCTGTTTGTTAGACTCTTACTCTCGAGAGTAAGAGTCTAACAAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005663.2-1614s1c1
Sequence:CCGGCTTCAAGAAGTACAAGCCCATCTCGAGATGGGCTTGTACTTCTTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005663.2-402s1c1
Sequence:CCGGGAATCCCAACGTTCAGGATATCTCGAGATATCCTGAACGTTGGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005663.2-481s1c1
Sequence:CCGGGAGTGCCAGTACTTGAACAAACTCGAGTTTGTTCAAGTACTGGCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011914
NELFA MISSION shRNA Bacterial Glycerol Stock
negative elongation factor complex member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011914.1-367s1c1
Sequence:CCGGCCCAATGTTCAAGACATCTTACTCGAGTAAGATGTCTTGAACATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011914.1-1326s1c1
Sequence:CCGGCCTCACTAGAGAACAGATGTTCTCGAGAACATCTGTTCTCTAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011914.1-1294s1c1
Sequence:CCGGCCTGTTCAGCAGCAACCTAAACTCGAGTTTAGGTTGCTGCTGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011914.1-1596s1c1
Sequence:CCGGGCCTATGACCAATGTGTCCTACTCGAGTAGGACACATTGGTCATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011914.1-1745s1c1
Sequence:CCGGGCCATTTCTCTGGAGAGTTTACTCGAGTAAACTCTCCAGAGAAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011914
NELFA MISSION shRNA shRNA Plasmid DNA
negative elongation factor complex member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011914.1-367s1c1
Sequence:CCGGCCCAATGTTCAAGACATCTTACTCGAGTAAGATGTCTTGAACATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011914.1-1326s1c1
Sequence:CCGGCCTCACTAGAGAACAGATGTTCTCGAGAACATCTGTTCTCTAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011914.1-1294s1c1
Sequence:CCGGCCTGTTCAGCAGCAACCTAAACTCGAGTTTAGGTTGCTGCTGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011914.1-1596s1c1
Sequence:CCGGGCCTATGACCAATGTGTCCTACTCGAGTAGGACACATTGGTCATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011914.1-1745s1c1
Sequence:CCGGGCCATTTCTCTGGAGAGTTTACTCGAGTAAACTCTCCAGAGAAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011914
NELFA MISSION shRNA Lentiviral Transduction Particles
negative elongation factor complex member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011914.1-367s1c1
Sequence:CCGGCCCAATGTTCAAGACATCTTACTCGAGTAAGATGTCTTGAACATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011914.1-1326s1c1
Sequence:CCGGCCTCACTAGAGAACAGATGTTCTCGAGAACATCTGTTCTCTAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011914.1-1294s1c1
Sequence:CCGGCCTGTTCAGCAGCAACCTAAACTCGAGTTTAGGTTGCTGCTGAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011914.1-1596s1c1
Sequence:CCGGGCCTATGACCAATGTGTCCTACTCGAGTAGGACACATTGGTCATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011914.1-1745s1c1
Sequence:CCGGGCCATTTCTCTGGAGAGTTTACTCGAGTAAACTCTCCAGAGAAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)