EMAIL THIS PAGE TO A FRIEND

NELFB

negative elongation factor complex member B

50 Gene Product Result for
Synonyms: COBRA1 NELF-B
UniProtKB ID: Q8WX92, A2BFA3, Q96EW5, Q9H9R4, Q9ULN8, Q9Y3W0
Gene ID:
Human(25920) Summary: NELFB is a subunit of negative elongation factor (NELF), which also includes NELFA (WHSC2; MIM 606026), either NELFC or NELFD (TH1L; MIM 605297), and NELFE (RDBP; MIM 154040). NELF acts with DRB sensitivity-inducing factor (DSIF), a heterodimer of SPT4 (SUPT4H1; MIM 603555) and SPT5 (SUPT5H; MIM 602102), to cause transcriptional pausing of RNA polymerase II (see MIM 180660) (Narita et al., 2003 [PubMed 12612062]
Mouse(58202) negative elongation factor complex member B, Cobra1
Rat(311796) negative elongation factor complex member B
domestic guinea pig(100714039) negative elongation factor complex member B
naked mole-rat(101711901) negative elongation factor complex member B
Zebrafish(393137) negative elongation factor complex member B
cow(512799) negative elongation factor complex member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015456 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015456 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015456 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021393 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021393 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021393 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015456 Rosetta Predictions human pricing
NM_001107817 Rosetta Predictions rat pricing
NM_021393 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236976 predicted 1422
2 SASI_Hs02_00347866 predicted 1750
3 SASI_Hs01_00236977 predicted 1335
4 SASI_Hs01_00236978 predicted 2162
5 SASI_Hs02_00347867 predicted 375
6 SASI_Hs01_00236980 predicted 1434
7 SASI_Hs01_00236982 predicted 1284
8 SASI_Hs01_00236983 predicted 2178
9 SASI_Hs01_00236984 predicted 843
10 SASI_Hs01_00236985 predicted 635
11 SASI_Hs01_00236979 predicted 1370
12 SASI_Hs01_00236981 predicted 1563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107817 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232565 predicted 445
2 SASI_Rn02_00232566 predicted 1768
3 SASI_Rn02_00232567 predicted 1473
4 SASI_Rn02_00232568 predicted 2001
5 SASI_Rn02_00232569 predicted 1583
6 SASI_Rn02_00232570 predicted 687
7 SASI_Rn02_00232571 predicted 317
8 SASI_Rn02_00232572 predicted 287
9 SASI_Rn02_00232573 predicted 697
10 SASI_Rn02_00232574 predicted 1432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021393 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110121 predicted 1540
2 SASI_Mm02_00325994 predicted 515
3 SASI_Mm01_00110122 predicted 1467
4 SASI_Mm02_00325995 predicted 386
5 SASI_Mm02_00325996 predicted 363
6 SASI_Mm01_00110124 predicted 2117
7 SASI_Mm01_00110125 predicted 1557
8 SASI_Mm01_00110126 predicted 1134
9 SASI_Mm01_00110127 predicted 2049
10 SASI_Mm01_00110128 predicted 1935
11 SASI_Mm01_00110123 predicted 870
12 SASI_Mm01_00110129 predicted 1600
13 SASI_Mm01_00110130 predicted 1895
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015456
VALIDATED
NELFB MISSION shRNA Bacterial Glycerol Stock
negative elongation factor complex member B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000146951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_015456.2-1170s1c1
Sequence:CCGGCACTTTCAATGTGGATCAGAACTCGAGTTCTGATCCACATTGAAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015456.2-1990s1c1
Sequence:CCGGCCATAGAAAGCGTGCTCATTTCTCGAGAAATGAGCACGCTTTCTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015456.3-1404s21c1
Sequence:CCGGGTCTCATATCCAAACACACTTCTCGAGAAGTGTGTTTGGATATGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015456.3-2178s21c1
Sequence:CCGGCCATAGAAAGCGTGCTCATTTCTCGAGAAATGAGCACGCTTTCTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015456.3-1358s21c1
Sequence:CCGGCACTTTCAATGTGGATCAGAACTCGAGTTCTGATCCACATTGAAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015456.2-1213s1c1
Sequence:CCGGCCAGTCTCATATCCAAACACACTCGAGTGTGTTTGGATATGAGACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015456.3-1426s21c1
Sequence:CCGGCCGAAAGCTTCACTAAGTTTCCTCGAGGAAACTTAGTGAAGCTTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015456
VALIDATED
NELFB MISSION shRNA shRNA Plasmid DNA
negative elongation factor complex member B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000146951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_015456.2-1170s1c1
Sequence:CCGGCACTTTCAATGTGGATCAGAACTCGAGTTCTGATCCACATTGAAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015456.2-1990s1c1
Sequence:CCGGCCATAGAAAGCGTGCTCATTTCTCGAGAAATGAGCACGCTTTCTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015456.3-1404s21c1
Sequence:CCGGGTCTCATATCCAAACACACTTCTCGAGAAGTGTGTTTGGATATGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015456.3-2178s21c1
Sequence:CCGGCCATAGAAAGCGTGCTCATTTCTCGAGAAATGAGCACGCTTTCTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015456.3-1358s21c1
Sequence:CCGGCACTTTCAATGTGGATCAGAACTCGAGTTCTGATCCACATTGAAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015456.2-1213s1c1
Sequence:CCGGCCAGTCTCATATCCAAACACACTCGAGTGTGTTTGGATATGAGACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015456.3-1426s21c1
Sequence:CCGGCCGAAAGCTTCACTAAGTTTCCTCGAGGAAACTTAGTGAAGCTTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015456
VALIDATED
NELFB MISSION shRNA Lentiviral Transduction Particles
negative elongation factor complex member B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000146951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_015456.2-1170s1c1
Sequence:CCGGCACTTTCAATGTGGATCAGAACTCGAGTTCTGATCCACATTGAAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015456.2-1990s1c1
Sequence:CCGGCCATAGAAAGCGTGCTCATTTCTCGAGAAATGAGCACGCTTTCTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015456.3-1404s21c1
Sequence:CCGGGTCTCATATCCAAACACACTTCTCGAGAAGTGTGTTTGGATATGAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015456.3-2178s21c1
Sequence:CCGGCCATAGAAAGCGTGCTCATTTCTCGAGAAATGAGCACGCTTTCTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015456.3-1358s21c1
Sequence:CCGGCACTTTCAATGTGGATCAGAACTCGAGTTCTGATCCACATTGAAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015456.2-1213s1c1
Sequence:CCGGCCAGTCTCATATCCAAACACACTCGAGTGTGTTTGGATATGAGACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015456.3-1426s21c1
Sequence:CCGGCCGAAAGCTTCACTAAGTTTCCTCGAGGAAACTTAGTGAAGCTTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021393
VALIDATED
NELFB MISSION shRNA Bacterial Glycerol Stock
negative elongation factor complex member B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021393.1-1743s1c1
Sequence:CCGGCCTGGACTTGTGGAAACGTTTCTCGAGAAACGTTTCCACAAGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021393.1-2427s1c1
Sequence:CCGGCCTGATATTCAATCTGCACAACTCGAGTTGTGCAGATTGAATATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021393.1-1451s1c1
Sequence:CCGGCCAAGGTGCATGGGACTTAATCTCGAGATTAAGTCCCATGCACCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021393.1-845s1c1
Sequence:CCGGGAGGCAGATTTGGCAAGACAACTCGAGTTGTCTTGCCAAATCTGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021393.1-1629s1c1
Sequence:CCGGCCTGAGAGTTTCACCAAGTTTCTCGAGAAACTTGGTGAAACTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021393.2-724s21c1
Sequence:CCGGGAGGCAGATTTGGCAAGACAACTCGAGTTGTCTTGCCAAATCTGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021393.2-2306s21c1
Sequence:CCGGCCTGATATTCAATCTGCACAACTCGAGTTGTGCAGATTGAATATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021393.2-1622s21c1
Sequence:CCGGCCTGGACTTGTGGAAACGTTTCTCGAGAAACGTTTCCACAAGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021393.2-1508s21c1
Sequence:CCGGCCTGAGAGTTTCACCAAGTTTCTCGAGAAACTTGGTGAAACTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021393
VALIDATED
NELFB MISSION shRNA shRNA Plasmid DNA
negative elongation factor complex member B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021393.1-1743s1c1
Sequence:CCGGCCTGGACTTGTGGAAACGTTTCTCGAGAAACGTTTCCACAAGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021393.1-2427s1c1
Sequence:CCGGCCTGATATTCAATCTGCACAACTCGAGTTGTGCAGATTGAATATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021393.1-1451s1c1
Sequence:CCGGCCAAGGTGCATGGGACTTAATCTCGAGATTAAGTCCCATGCACCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021393.1-845s1c1
Sequence:CCGGGAGGCAGATTTGGCAAGACAACTCGAGTTGTCTTGCCAAATCTGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021393.1-1629s1c1
Sequence:CCGGCCTGAGAGTTTCACCAAGTTTCTCGAGAAACTTGGTGAAACTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021393.2-724s21c1
Sequence:CCGGGAGGCAGATTTGGCAAGACAACTCGAGTTGTCTTGCCAAATCTGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021393.2-2306s21c1
Sequence:CCGGCCTGATATTCAATCTGCACAACTCGAGTTGTGCAGATTGAATATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021393.2-1622s21c1
Sequence:CCGGCCTGGACTTGTGGAAACGTTTCTCGAGAAACGTTTCCACAAGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021393.2-1508s21c1
Sequence:CCGGCCTGAGAGTTTCACCAAGTTTCTCGAGAAACTTGGTGAAACTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021393
VALIDATED
NELFB MISSION shRNA Lentiviral Transduction Particles
negative elongation factor complex member B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021393.1-1743s1c1
Sequence:CCGGCCTGGACTTGTGGAAACGTTTCTCGAGAAACGTTTCCACAAGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021393.1-2427s1c1
Sequence:CCGGCCTGATATTCAATCTGCACAACTCGAGTTGTGCAGATTGAATATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021393.1-1451s1c1
Sequence:CCGGCCAAGGTGCATGGGACTTAATCTCGAGATTAAGTCCCATGCACCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021393.1-845s1c1
Sequence:CCGGGAGGCAGATTTGGCAAGACAACTCGAGTTGTCTTGCCAAATCTGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021393.1-1629s1c1
Sequence:CCGGCCTGAGAGTTTCACCAAGTTTCTCGAGAAACTTGGTGAAACTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021393.2-724s21c1
Sequence:CCGGGAGGCAGATTTGGCAAGACAACTCGAGTTGTCTTGCCAAATCTGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021393.2-2306s21c1
Sequence:CCGGCCTGATATTCAATCTGCACAACTCGAGTTGTGCAGATTGAATATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021393.2-1622s21c1
Sequence:CCGGCCTGGACTTGTGGAAACGTTTCTCGAGAAACGTTTCCACAAGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021393.2-1508s21c1
Sequence:CCGGCCTGAGAGTTTCACCAAGTTTCTCGAGAAACTTGGTGAAACTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)