EMAIL THIS PAGE TO A FRIEND

NELFCD

negative elongation factor complex member C/D

87 Gene Product Result for
Synonyms: NELF-C NELF-D TH1 TH1L
Gene ID:
Human(51497) Summary: The NELF complex of proteins interacts with the DSIF protein complex to repress transcriptional elongation by RNA polymerase II. The protein encoded by this gene is an essential part of the NELF complex. Alternative translation initiation site usage results in the formation of two isoforms with different N-termini. [provided by RefSeq, Jul 2008]
Mouse(57314) negative elongation factor complex member C/D, Th1l
Rat(679203) negative elongation factor complex member C/D
Zebrafish(394165) negative elongation factor complex member C/D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198976 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198976 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198976 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020580 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020580 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020580 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016397 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016397 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016397 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198976 Rosetta Predictions human pricing
XM_001054731 Rosetta Predictions rat pricing
XM_001054856 Rosetta Predictions rat pricing
XM_001054969 Rosetta Predictions rat pricing
XM_001055035 Rosetta Predictions rat pricing
NM_020580 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198976 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026267 predicted 1642
2 SASI_Hs01_00026268 predicted 1778
3 SASI_Hs01_00026269 predicted 836
4 SASI_Hs01_00026270 predicted 1638
5 SASI_Hs01_00026271 predicted 1773
6 SASI_Hs02_00372488 predicted 1559
7 SASI_Hs01_00026272 predicted 252
8 SASI_Hs01_00026274 predicted 948
9 SASI_Hs01_00026276 predicted 1599
10 SASI_Hs02_00372489 predicted 955
11 SASI_Hs01_00026273 predicted 1339
12 SASI_Hs01_00026275 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054731 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276979 predicted 505
2 SASI_Rn02_00276980 predicted 1830
3 SASI_Rn02_00276981 predicted 737
4 SASI_Rn02_00276982 predicted 1812
5 SASI_Rn02_00276983 predicted 692
6 SASI_Rn02_00276984 predicted 1376
7 SASI_Rn02_00276985 predicted 1659
8 SASI_Rn02_00276986 predicted 1302
9 SASI_Rn02_00276987 predicted 1067
10 SASI_Rn02_00276988 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054856 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277515 predicted 544
2 SASI_Rn02_00277516 predicted 1868
3 SASI_Rn02_00277517 predicted 778
4 SASI_Rn02_00277518 predicted 233
5 SASI_Rn02_00277519 predicted 731
6 SASI_Rn02_00277520 predicted 1410
7 SASI_Rn02_00277521 predicted 1688
8 SASI_Rn02_00277522 predicted 1342
9 SASI_Rn02_00277523 predicted 1108
10 SASI_Rn02_00277524 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054969 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277872 predicted 479
2 SASI_Rn02_00277873 predicted 1813
3 SASI_Rn02_00277874 predicted 716
4 SASI_Rn02_00277875 predicted 1798
5 SASI_Rn02_00277876 predicted 664
6 SASI_Rn02_00277877 predicted 1364
7 SASI_Rn02_00277878 predicted 1635
8 SASI_Rn02_00277879 predicted 284
9 SASI_Rn02_00277880 predicted 234
10 SASI_Rn02_00277881 predicted 960
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055035 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278162 predicted 505
2 SASI_Rn02_00278163 predicted 1828
3 SASI_Rn02_00278164 predicted 735
4 SASI_Rn02_00278165 predicted 1808
5 SASI_Rn02_00278166 predicted 192
6 SASI_Rn02_00278167 predicted 689
7 SASI_Rn02_00278168 predicted 1371
8 SASI_Rn02_00278169 predicted 1652
9 SASI_Rn02_00278170 predicted 1304
10 SASI_Rn02_00278171 predicted 1066
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020580 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089226 predicted 1301
2 SASI_Mm01_00089227 predicted 415
3 SASI_Mm02_00325648 predicted 1810
4 SASI_Mm01_00089229 predicted 993
5 SASI_Mm01_00089230 predicted 1600
6 SASI_Mm01_00089232 predicted 195
7 SASI_Mm01_00089233 predicted 619
8 SASI_Mm01_00089234 predicted 1912
9 SASI_Mm01_00089235 predicted 1071
10 SASI_Mm02_00325649 predicted 1410
11 SASI_Mm01_00089228 predicted 590
12 SASI_Mm01_00089231 predicted 512
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198976
VALIDATED
NELFCD MISSION shRNA Bacterial Glycerol Stock
negative elongation factor complex member C/D
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_198976.1-413s21c1
Sequence:CCGGCCCGCAAAGCAGATTCTATTTCTCGAGAAATAGAATCTGCTTTGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_198976.1-1781s21c1
Sequence:GTACCGGACTTCATCATGGTGAACTAATCTCGAGATTAGTTCACCATGATGAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_198976.1-1146s21c1
Sequence:CCGGCAAGCGAGTGAGCATCAATAACTCGAGTTATTGATGCTCACTCGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_198976.1-1742s21c1
Sequence:CCGGATGACCCTGTGACGGAGTTTACTCGAGTAAACTCCGTCACAGGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229877    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_198976.1-2002s21c1
Sequence:CCGGATCCAATACTGCTCCCAAATCCTCGAGGATTTGGGAGCAGTATTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198976
VALIDATED
NELFCD MISSION shRNA shRNA Plasmid DNA
negative elongation factor complex member C/D
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_198976.1-413s21c1
Sequence:CCGGCCCGCAAAGCAGATTCTATTTCTCGAGAAATAGAATCTGCTTTGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_198976.1-1781s21c1
Sequence:GTACCGGACTTCATCATGGTGAACTAATCTCGAGATTAGTTCACCATGATGAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_198976.1-1146s21c1
Sequence:CCGGCAAGCGAGTGAGCATCAATAACTCGAGTTATTGATGCTCACTCGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_198976.1-1742s21c1
Sequence:CCGGATGACCCTGTGACGGAGTTTACTCGAGTAAACTCCGTCACAGGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229877    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_198976.1-2002s21c1
Sequence:CCGGATCCAATACTGCTCCCAAATCCTCGAGGATTTGGGAGCAGTATTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198976
VALIDATED
NELFCD MISSION shRNA Lentiviral Transduction Particles
negative elongation factor complex member C/D
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_198976.1-413s21c1
Sequence:CCGGCCCGCAAAGCAGATTCTATTTCTCGAGAAATAGAATCTGCTTTGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_198976.1-1781s21c1
Sequence:GTACCGGACTTCATCATGGTGAACTAATCTCGAGATTAGTTCACCATGATGAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_198976.1-1146s21c1
Sequence:CCGGCAAGCGAGTGAGCATCAATAACTCGAGTTATTGATGCTCACTCGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_198976.1-1742s21c1
Sequence:CCGGATGACCCTGTGACGGAGTTTACTCGAGTAAACTCCGTCACAGGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229877    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_198976.1-2002s21c1
Sequence:CCGGATCCAATACTGCTCCCAAATCCTCGAGGATTTGGGAGCAGTATTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020580
VALIDATED
NELFCD MISSION shRNA Bacterial Glycerol Stock
negative elongation factor complex member C/D
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020580.1-1660s1c1
Sequence:CCGGCGCTACTTTGTCACTGAGGTTCTCGAGAACCTCAGTGACAAAGTAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193622    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020580.1-1849s1c1
Sequence:CCGGCTGTAACTGAAGCCGAAACTTCTCGAGAAGTTTCGGCTTCAGTTACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020580.1-1255s1c1
Sequence:CCGGCTGTGCTGCAACGAGAACAAACTCGAGTTTGTTCTCGTTGCAGCACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020580.3-1255s21c4
Sequence:CCGGCTGTGCTGCAACGAGAACAAACTCGAGTTTGTTCTCGTTGCAGCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020580.3-1849s21c3
Sequence:CCGGCTGTAACTGAAGCCGAAACTTCTCGAGAAGTTTCGGCTTCAGTTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020580.3-1604s21c1
Sequence:CCGGTGGTCAGTTATATCCGCAAATCTCGAGATTTGCGGATATAACTGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020580.3-1213s21c1
Sequence:CCGGGAGCTCAAGTCCACGTCAAAGCTCGAGCTTTGACGTGGACTTGAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020580.1-743s1c1
Sequence:CCGGCTGAGTTTGCAAAGATGGTATCTCGAGATACCATCTTTGCAAACTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020580
VALIDATED
NELFCD MISSION shRNA shRNA Plasmid DNA
negative elongation factor complex member C/D
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020580.1-1660s1c1
Sequence:CCGGCGCTACTTTGTCACTGAGGTTCTCGAGAACCTCAGTGACAAAGTAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193622    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020580.1-1849s1c1
Sequence:CCGGCTGTAACTGAAGCCGAAACTTCTCGAGAAGTTTCGGCTTCAGTTACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020580.1-1255s1c1
Sequence:CCGGCTGTGCTGCAACGAGAACAAACTCGAGTTTGTTCTCGTTGCAGCACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020580.3-1255s21c4
Sequence:CCGGCTGTGCTGCAACGAGAACAAACTCGAGTTTGTTCTCGTTGCAGCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020580.3-1849s21c3
Sequence:CCGGCTGTAACTGAAGCCGAAACTTCTCGAGAAGTTTCGGCTTCAGTTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020580.3-1604s21c1
Sequence:CCGGTGGTCAGTTATATCCGCAAATCTCGAGATTTGCGGATATAACTGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020580.3-1213s21c1
Sequence:CCGGGAGCTCAAGTCCACGTCAAAGCTCGAGCTTTGACGTGGACTTGAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020580.1-743s1c1
Sequence:CCGGCTGAGTTTGCAAAGATGGTATCTCGAGATACCATCTTTGCAAACTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020580
VALIDATED
NELFCD MISSION shRNA Lentiviral Transduction Particles
negative elongation factor complex member C/D
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020580.1-1660s1c1
Sequence:CCGGCGCTACTTTGTCACTGAGGTTCTCGAGAACCTCAGTGACAAAGTAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193622    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020580.1-1849s1c1
Sequence:CCGGCTGTAACTGAAGCCGAAACTTCTCGAGAAGTTTCGGCTTCAGTTACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020580.1-1255s1c1
Sequence:CCGGCTGTGCTGCAACGAGAACAAACTCGAGTTTGTTCTCGTTGCAGCACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020580.3-1255s21c4
Sequence:CCGGCTGTGCTGCAACGAGAACAAACTCGAGTTTGTTCTCGTTGCAGCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020580.3-1849s21c3
Sequence:CCGGCTGTAACTGAAGCCGAAACTTCTCGAGAAGTTTCGGCTTCAGTTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020580.3-1604s21c1
Sequence:CCGGTGGTCAGTTATATCCGCAAATCTCGAGATTTGCGGATATAACTGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020580.3-1213s21c1
Sequence:CCGGGAGCTCAAGTCCACGTCAAAGCTCGAGCTTTGACGTGGACTTGAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020580.1-743s1c1
Sequence:CCGGCTGAGTTTGCAAAGATGGTATCTCGAGATACCATCTTTGCAAACTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016397
VALIDATED
NELFCD MISSION shRNA Bacterial Glycerol Stock
negative elongation factor complex member C/D
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016397.2-413s1c1
Sequence:CCGGCCCGCAAAGCAGATTCTATTTCTCGAGAAATAGAATCTGCTTTGCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016397.2-462s1c1
Sequence:CCGGGCTGGAACAGATGATTGCACACTCGAGTGTGCAATCATCTGTTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016397.2-1603s1c1
Sequence:CCGGGACATTTCACTCATTCGCTATCTCGAGATAGCGAATGAGTGAAATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_016397.2-1754s1c1
Sequence:CCGGCGGAGTTTATAGCTCACTGCACTCGAGTGCAGTGAGCTATAAACTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016397.2-256s1c1
Sequence:CCGGGAGAATGTTATCCAGCTCTTACTCGAGTAAGAGCTGGATAACATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016397.2-1820s1c1
Sequence:CCGGCTGAAGCAGAACATTCCAGAACTCGAGTTCTGGAATGTTCTGCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016397.2-1826s1c1
Sequence:CCGGCAGAACATTCCAGAACCCGTTCTCGAGAACGGGTTCTGGAATGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016397
VALIDATED
NELFCD MISSION shRNA shRNA Plasmid DNA
negative elongation factor complex member C/D
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016397.2-413s1c1
Sequence:CCGGCCCGCAAAGCAGATTCTATTTCTCGAGAAATAGAATCTGCTTTGCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016397.2-462s1c1
Sequence:CCGGGCTGGAACAGATGATTGCACACTCGAGTGTGCAATCATCTGTTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016397.2-1603s1c1
Sequence:CCGGGACATTTCACTCATTCGCTATCTCGAGATAGCGAATGAGTGAAATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_016397.2-1754s1c1
Sequence:CCGGCGGAGTTTATAGCTCACTGCACTCGAGTGCAGTGAGCTATAAACTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016397.2-256s1c1
Sequence:CCGGGAGAATGTTATCCAGCTCTTACTCGAGTAAGAGCTGGATAACATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016397.2-1820s1c1
Sequence:CCGGCTGAAGCAGAACATTCCAGAACTCGAGTTCTGGAATGTTCTGCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016397.2-1826s1c1
Sequence:CCGGCAGAACATTCCAGAACCCGTTCTCGAGAACGGGTTCTGGAATGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016397
VALIDATED
NELFCD MISSION shRNA Lentiviral Transduction Particles
negative elongation factor complex member C/D
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016397.2-413s1c1
Sequence:CCGGCCCGCAAAGCAGATTCTATTTCTCGAGAAATAGAATCTGCTTTGCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016397.2-462s1c1
Sequence:CCGGGCTGGAACAGATGATTGCACACTCGAGTGTGCAATCATCTGTTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016397.2-1603s1c1
Sequence:CCGGGACATTTCACTCATTCGCTATCTCGAGATAGCGAATGAGTGAAATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_016397.2-1754s1c1
Sequence:CCGGCGGAGTTTATAGCTCACTGCACTCGAGTGCAGTGAGCTATAAACTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016397.2-256s1c1
Sequence:CCGGGAGAATGTTATCCAGCTCTTACTCGAGTAAGAGCTGGATAACATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016397.2-1820s1c1
Sequence:CCGGCTGAAGCAGAACATTCCAGAACTCGAGTTCTGGAATGTTCTGCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016397.2-1826s1c1
Sequence:CCGGCAGAACATTCCAGAACCCGTTCTCGAGAACGGGTTCTGGAATGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)