EMAIL THIS PAGE TO A FRIEND

NELFE

negative elongation factor complex member E

121 Gene Product Result for
Synonyms: D6S45 NELF-E RD RDBP RDP
UniProtKB ID: P18615, A2BE08, Q5JP74, Q5JP75, Q96F56, Q9NPK2
Gene ID:
Human(7936) Summary: The protein encoded by this gene is part of a complex termed negative elongation factor (NELF) which represses RNA polymerase II transcript elongation. This protein bears similarity to nuclear RNA-binding proteins; however, it has not been demonstrated that this protein binds RNA. The protein contains a tract of alternating basic and acidic residues, largely arginine (R) and aspartic acid (D). The gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. [provided by RefSeq, Jul 2008]
Mouse(27632) negative elongation factor complex member E, Rdbp
Rat(294258) negative elongation factor complex member E
domestic guinea pig(100715335) negative elongation factor complex member E
naked mole-rat(101713224) negative elongation factor complex member E
Zebrafish(436648) negative elongation factor complex member E
cow(540158) RD RNA binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138580 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138580 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138580 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002904 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002904 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002904 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002904 Rosetta Predictions human pricing
NM_212548 Rosetta Predictions rat pricing
XM_579742 Rosetta Predictions rat pricing
NM_001045863 Rosetta Predictions mouse pricing
NM_001045864 Rosetta Predictions mouse pricing
NM_138580 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002904 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179520 predicted 1286
2 SASI_Hs01_00179521 predicted 534
3 SASI_Hs02_00334715 predicted 405
4 SASI_Hs01_00179522 predicted 1163
5 SASI_Hs01_00179524 predicted 1324
6 SASI_Hs01_00179525 predicted 425
7 SASI_Hs01_00179526 predicted 461
8 SASI_Hs01_00179527 predicted 313
9 SASI_Hs01_00179528 predicted 1157
10 SASI_Hs02_00334716 predicted 347
11 SASI_Hs01_00179523 predicted 335
12 SASI_Hs01_00179529 predicted 1168
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212548 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042513 predicted 679
2 SASI_Rn02_00270574 predicted 238
3 SASI_Rn02_00270575 predicted 825
4 SASI_Rn01_00042514 predicted 265
5 SASI_Rn02_00270576 predicted 1022
6 SASI_Rn01_00042515 predicted 510
7 SASI_Rn01_00042516 predicted 506
8 SASI_Rn02_00270577 predicted 1026
9 SASI_Rn01_00042518 predicted 497
10 SASI_Rn01_00042519 predicted 315
11 SASI_Rn01_00042512 predicted 1570
12 SASI_Rn01_00042517 predicted 692
13 SASI_Rn01_00042520 predicted 1410
14 SASI_Rn01_00042521 predicted 1545
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579742 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00136899 predicted 494
2 SASI_Rn01_00136900 predicted 708
3 SASI_Rn01_00136901 predicted 654
4 SASI_Rn01_00136902 predicted 887
5 SASI_Rn01_00136903 predicted 331
6 SASI_Rn01_00136904 predicted 335
7 SASI_Rn01_00136905 predicted 854
8 SASI_Rn01_00136906 predicted 320
9 SASI_Rn01_00136907 predicted 883
10 SASI_Rn01_00136908 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001045863 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291841 predicted 1205
2 SASI_Mm02_00291842 predicted 539
3 SASI_Mm02_00291843 predicted 436
4 SASI_Mm02_00291844 predicted 1288
5 SASI_Mm02_00291845 predicted 453
6 SASI_Mm02_00291846 predicted 1156
7 SASI_Mm02_00291847 predicted 1272
8 SASI_Mm02_00291848 predicted 1142
9 SASI_Mm02_00291849 predicted 1118
10 SASI_Mm02_00291850 predicted 1249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001045864 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291851 predicted 1292
2 SASI_Mm02_00291852 predicted 523
3 SASI_Mm02_00291853 predicted 1372
4 SASI_Mm02_00291854 predicted 544
5 SASI_Mm02_00291855 predicted 1244
6 SASI_Mm02_00291856 predicted 1365
7 SASI_Mm02_00291857 predicted 1234
8 SASI_Mm02_00291858 predicted 1233
9 SASI_Mm02_00291859 predicted 1337
10 SASI_Mm02_00291860 predicted 1362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138580 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339626 predicted 1077
2 SASI_Mm02_00339627 predicted 412
3 SASI_Mm01_00037011 predicted 305
4 SASI_Mm02_00339628 predicted 1164
5 SASI_Mm01_00037012 predicted 325
6 SASI_Mm02_00339629 predicted 1028
7 SASI_Mm02_00339630 predicted 1154
8 SASI_Mm02_00339631 predicted 1022
9 SASI_Mm02_00339632 predicted 995
10 SASI_Mm02_00339633 predicted 1127
11 SASI_Mm01_00037013 predicted 232
12 SASI_Mm01_00037014 predicted 386
13 SASI_Mm01_00037015 predicted 343
14 SASI_Mm01_00037016 predicted 222
15 SASI_Mm01_00037017 predicted 229
16 SASI_Mm01_00037018 predicted 334
17 SASI_Mm01_00037019 predicted 894
18 SASI_Mm01_00037020 predicted 220
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138580
VALIDATED
NELFE MISSION shRNA Bacterial Glycerol Stock
negative elongation factor complex member E
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138580.1-490s1c1
Sequence:CCGGCGAGGCTTTGACTGGAGCTATCTCGAGATAGCTCCAGTCAAAGCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138580.1-970s1c1
Sequence:CCGGGTGGAATCTGTGCAGCTTAAACTCGAGTTTAAGCTGCACAGATTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138580.1-237s1c1
Sequence:CCGGTGAAACTAAGAACTCAGGCTTCTCGAGAAGCCTGAGTTCTTAGTTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138580.1-858s1c1
Sequence:CCGGCTTTGGAAATATCATCGACCTCTCGAGAGGTCGATGATATTTCCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138580.1-48s1c1
Sequence:CCGGGAAGGAGTTCAACAAACTCAACTCGAGTTGAGTTTGTTGAACTCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138580.2-350s21c1
Sequence:CCGGGACCCTGGAAGGGAAGTTAAACTCGAGTTTAACTTCCCTTCCAGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138580.2-804s21c1
Sequence:CCGGTTCCGCAGGTCAGACTCATTCCTCGAGGAATGAGTCTGACCTGCGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138580.2-1075s21c1
Sequence:CCGGTGGACGCTGCTACTGGCAAATCTCGAGATTTGCCAGTAGCAGCGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138580.2-1218s21c1
Sequence:CCGGTGGATTCCTTGTGCCTCATATCTCGAGATATGAGGCACAAGGAATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138580
VALIDATED
NELFE MISSION shRNA shRNA Plasmid DNA
negative elongation factor complex member E
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138580.1-490s1c1
Sequence:CCGGCGAGGCTTTGACTGGAGCTATCTCGAGATAGCTCCAGTCAAAGCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138580.1-970s1c1
Sequence:CCGGGTGGAATCTGTGCAGCTTAAACTCGAGTTTAAGCTGCACAGATTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138580.1-237s1c1
Sequence:CCGGTGAAACTAAGAACTCAGGCTTCTCGAGAAGCCTGAGTTCTTAGTTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138580.1-858s1c1
Sequence:CCGGCTTTGGAAATATCATCGACCTCTCGAGAGGTCGATGATATTTCCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138580.1-48s1c1
Sequence:CCGGGAAGGAGTTCAACAAACTCAACTCGAGTTGAGTTTGTTGAACTCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138580.2-350s21c1
Sequence:CCGGGACCCTGGAAGGGAAGTTAAACTCGAGTTTAACTTCCCTTCCAGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138580.2-804s21c1
Sequence:CCGGTTCCGCAGGTCAGACTCATTCCTCGAGGAATGAGTCTGACCTGCGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138580.2-1075s21c1
Sequence:CCGGTGGACGCTGCTACTGGCAAATCTCGAGATTTGCCAGTAGCAGCGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138580.2-1218s21c1
Sequence:CCGGTGGATTCCTTGTGCCTCATATCTCGAGATATGAGGCACAAGGAATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138580
VALIDATED
NELFE MISSION shRNA Lentiviral Transduction Particles
negative elongation factor complex member E
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138580.1-490s1c1
Sequence:CCGGCGAGGCTTTGACTGGAGCTATCTCGAGATAGCTCCAGTCAAAGCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138580.1-970s1c1
Sequence:CCGGGTGGAATCTGTGCAGCTTAAACTCGAGTTTAAGCTGCACAGATTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138580.1-237s1c1
Sequence:CCGGTGAAACTAAGAACTCAGGCTTCTCGAGAAGCCTGAGTTCTTAGTTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138580.1-858s1c1
Sequence:CCGGCTTTGGAAATATCATCGACCTCTCGAGAGGTCGATGATATTTCCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138580.1-48s1c1
Sequence:CCGGGAAGGAGTTCAACAAACTCAACTCGAGTTGAGTTTGTTGAACTCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138580.2-350s21c1
Sequence:CCGGGACCCTGGAAGGGAAGTTAAACTCGAGTTTAACTTCCCTTCCAGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138580.2-804s21c1
Sequence:CCGGTTCCGCAGGTCAGACTCATTCCTCGAGGAATGAGTCTGACCTGCGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138580.2-1075s21c1
Sequence:CCGGTGGACGCTGCTACTGGCAAATCTCGAGATTTGCCAGTAGCAGCGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138580.2-1218s21c1
Sequence:CCGGTGGATTCCTTGTGCCTCATATCTCGAGATATGAGGCACAAGGAATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002904
VALIDATED
NELFE MISSION shRNA Bacterial Glycerol Stock
negative elongation factor complex member E
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002904.4-1261s1c1
Sequence:CCGGCTGGATTCCTTGTGCCTCATACTCGAGTATGAGGCACAAGGAATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002904.4-239s1c1
Sequence:CCGGGTGGTGTCAAACGCTCACTATCTCGAGATAGTGAGCGTTTGACACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002904.4-900s1c1
Sequence:CCGGCTATGTATATGGAGAAGACATCTCGAGATGTCTTCTCCATATACATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002904.4-1195s1c1
Sequence:CCGGACCCAGATTGTCTACAGTGATCTCGAGATCACTGTAGACAATCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002904.4-1083s1c1
Sequence:CCGGCAAAGTCAACATAGCCCGAAACTCGAGTTTCGGGCTATGTTGACTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002904.5-1179s21c1
Sequence:CCGGCAAAGTCAACATAGCCCGAAACTCGAGTTTCGGGCTATGTTGACTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002904.5-335s21c1
Sequence:CCGGGTGGTGTCAAACGCTCACTATCTCGAGATAGTGAGCGTTTGACACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002904.5-1291s21c1
Sequence:CCGGACCCAGATTGTCTACAGTGATCTCGAGATCACTGTAGACAATCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002904.5-1357s21c1
Sequence:CCGGCTGGATTCCTTGTGCCTCATACTCGAGTATGAGGCACAAGGAATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002904
VALIDATED
NELFE MISSION shRNA shRNA Plasmid DNA
negative elongation factor complex member E
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002904.4-1261s1c1
Sequence:CCGGCTGGATTCCTTGTGCCTCATACTCGAGTATGAGGCACAAGGAATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002904.4-239s1c1
Sequence:CCGGGTGGTGTCAAACGCTCACTATCTCGAGATAGTGAGCGTTTGACACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002904.4-900s1c1
Sequence:CCGGCTATGTATATGGAGAAGACATCTCGAGATGTCTTCTCCATATACATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002904.4-1195s1c1
Sequence:CCGGACCCAGATTGTCTACAGTGATCTCGAGATCACTGTAGACAATCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002904.4-1083s1c1
Sequence:CCGGCAAAGTCAACATAGCCCGAAACTCGAGTTTCGGGCTATGTTGACTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002904.5-1179s21c1
Sequence:CCGGCAAAGTCAACATAGCCCGAAACTCGAGTTTCGGGCTATGTTGACTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002904.5-335s21c1
Sequence:CCGGGTGGTGTCAAACGCTCACTATCTCGAGATAGTGAGCGTTTGACACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002904.5-1291s21c1
Sequence:CCGGACCCAGATTGTCTACAGTGATCTCGAGATCACTGTAGACAATCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002904.5-1357s21c1
Sequence:CCGGCTGGATTCCTTGTGCCTCATACTCGAGTATGAGGCACAAGGAATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002904
VALIDATED
NELFE MISSION shRNA Lentiviral Transduction Particles
negative elongation factor complex member E
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002904.4-1261s1c1
Sequence:CCGGCTGGATTCCTTGTGCCTCATACTCGAGTATGAGGCACAAGGAATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002904.4-239s1c1
Sequence:CCGGGTGGTGTCAAACGCTCACTATCTCGAGATAGTGAGCGTTTGACACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002904.4-900s1c1
Sequence:CCGGCTATGTATATGGAGAAGACATCTCGAGATGTCTTCTCCATATACATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002904.4-1195s1c1
Sequence:CCGGACCCAGATTGTCTACAGTGATCTCGAGATCACTGTAGACAATCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002904.4-1083s1c1
Sequence:CCGGCAAAGTCAACATAGCCCGAAACTCGAGTTTCGGGCTATGTTGACTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002904.5-1179s21c1
Sequence:CCGGCAAAGTCAACATAGCCCGAAACTCGAGTTTCGGGCTATGTTGACTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002904.5-335s21c1
Sequence:CCGGGTGGTGTCAAACGCTCACTATCTCGAGATAGTGAGCGTTTGACACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002904.5-1291s21c1
Sequence:CCGGACCCAGATTGTCTACAGTGATCTCGAGATCACTGTAGACAATCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002904.5-1357s21c1
Sequence:CCGGCTGGATTCCTTGTGCCTCATACTCGAGTATGAGGCACAAGGAATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)