EMAIL THIS PAGE TO A FRIEND

NELL2

NEL-like 2 (chicken)

127 Gene Product Result for
Synonyms: NRP2
UniProtKB ID: Q99435, B7Z2U7, B7Z5Q4, B7Z9J5, B7Z9U3, Q96JS2
Gene ID:
Human(4753) Summary: The protein encoded by this gene is a glycoprotein containing several von Willebrand factor C domains and epidermal growth factor (EGF)-like domains. The encoded protein acts as a homotrimer and is found in the cytoplasm. Several variants encoding a few different isoforms exist, and at least one isoform appears to be a secreted protein. Studies in mouse suggest that this protein plays a role in neural cell growth and differentiation as well as in oncogenesis. [provided by RefSeq, Feb 2009]
Mouse(54003) NEL-like 2
Rat(81734) NEL-like 2 (chicken)
chicken(417799) NEL-like 2
cow(524622) NEL-like 2 (chicken)
domestic cat(101081559) NEL-like 2 (chicken)
Horse(100054944) NEL-like 2 (chicken)
dog(477636) NEL-like 2 (chicken)
domestic guinea pig(100729197) NEL-like 2 (chicken)
naked mole-rat(101725756) NEL-like 2 (chicken)
sheep(101113484) NEL-like 2 (chicken)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006159 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006159 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006159 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016743 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016743 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016743 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU030171 MISSION® esiRNA esiRNA human NELL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006159 Rosetta Predictions human pricing
NM_031070 Rosetta Predictions rat pricing
XM_001058690 Rosetta Predictions rat pricing
XM_579504 Rosetta Predictions rat pricing
NM_016743 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006159 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215637 predicted 1620
2 SASI_Hs01_00215639 predicted 1270
3 SASI_Hs02_00341005 predicted 1108
4 SASI_Hs01_00215641 predicted 1241
5 SASI_Hs01_00215642 predicted 276
6 SASI_Hs01_00215643 predicted 1069
7 SASI_Hs01_00215645 predicted 703
8 SASI_Hs02_00341006 predicted 458
9 SASI_Hs02_00341007 predicted 1954
10 SASI_Hs02_00341008 predicted 1690
11 SASI_Hs01_00215638 predicted 2645
12 SASI_Hs01_00215640 predicted 262
13 SASI_Hs01_00215644 predicted 1159
14 SASI_Hs01_00215646 predicted 1359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031070 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096433 predicted 1915
2 SASI_Rn01_00096434 predicted 1166
3 SASI_Rn01_00096437 predicted 363
4 SASI_Rn01_00096438 predicted 1535
5 SASI_Rn01_00096439 predicted 254
6 SASI_Rn01_00096440 predicted 686
7 SASI_Rn01_00096441 predicted 652
8 SASI_Rn01_00096442 predicted 838
9 SASI_Rn02_00264314 predicted 453
10 SASI_Rn02_00264315 predicted 957
11 SASI_Rn01_00096435 predicted 857
12 SASI_Rn01_00096436 predicted 1642
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058690 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290519 predicted 1477
2 SASI_Rn02_00290520 predicted 671
3 SASI_Rn02_00290521 predicted 569
4 SASI_Rn02_00290522 predicted 998
5 SASI_Rn02_00290523 predicted 963
6 SASI_Rn02_00290524 predicted 648
7 SASI_Rn02_00290525 predicted 1147
8 SASI_Rn02_00290526 predicted 768
9 SASI_Rn02_00290527 predicted 1274
10 SASI_Rn02_00290528 predicted 1564
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579504 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00126973 predicted 1133
2 SASI_Rn01_00126974 predicted 1258
3 SASI_Rn01_00126975 predicted 1168
4 SASI_Rn01_00126976 predicted 1133
5 SASI_Rn01_00126977 predicted 1161
6 SASI_Rn01_00126978 predicted 1267
7 SASI_Rn01_00126979 predicted 1253
8 SASI_Rn01_00126980 predicted 1223
9 SASI_Rn01_00126981 predicted 1173
10 SASI_Rn01_00126982 predicted 1237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016743 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126047 predicted 1665
2 SASI_Mm01_00126049 predicted 1446
3 SASI_Mm01_00126050 predicted 543
4 SASI_Mm02_00323466 predicted 1038
5 SASI_Mm02_00323467 predicted 727
6 SASI_Mm01_00126051 predicted 1430
7 SASI_Mm01_00126052 predicted 620
8 SASI_Mm02_00323468 predicted 274
9 SASI_Mm01_00126054 predicted 1411
10 SASI_Mm01_00126055 predicted 1827
11 SASI_Mm01_00126048 predicted 311
12 SASI_Mm01_00126053 predicted 1408
13 SASI_Mm01_00126056 predicted 1179
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006159
VALIDATED
NELL2 MISSION shRNA Bacterial Glycerol Stock
NEL-like 2 (chicken)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006159.1-940s1c1
Sequence:CCGGCGAGAATTTGAGTCCTGGATACTCGAGTATCCAGGACTCAAATTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006159.1-1115s1c1
Sequence:CCGGCCTACTTTGAAGGAGAAAGAACTCGAGTTCTTTCTCCTTCAAAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_006159.1-383s1c1
Sequence:CCGGCCCACTTAAATTCAGGAGTTACTCGAGTAACTCCTGAATTTAAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006159.1-1952s1c1
Sequence:CCGGGCTTCAATTTGGATGGCGGATCTCGAGATCCGCCATCCAAATTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_006159.1-176s1c1
Sequence:CCGGCCCTACAGATTGACGTCTTAACTCGAGTTAAGACGTCAATCTGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006159.2-1897s21c1
Sequence:CCGGATGTGACAGTCGTGCTAATTGCTCGAGCAATTAGCACGACTGTCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006159.2-1046s21c1
Sequence:CCGGCGAGAATTTGAGTCCTGGATACTCGAGTATCCAGGACTCAAATTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006159.2-1221s21c1
Sequence:CCGGCCTACTTTGAAGGAGAAAGAACTCGAGTTCTTTCTCCTTCAAAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006159.2-2058s21c1
Sequence:CCGGGCTTCAATTTGGATGGCGGATCTCGAGATCCGCCATCCAAATTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006159.2-3080s21c1
Sequence:CCGGGTAAAGCAAAGAAGCTATAACCTCGAGGTTATAGCTTCTTTGCTTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006159
VALIDATED
NELL2 MISSION shRNA shRNA Plasmid DNA
NEL-like 2 (chicken)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006159.1-940s1c1
Sequence:CCGGCGAGAATTTGAGTCCTGGATACTCGAGTATCCAGGACTCAAATTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006159.1-1115s1c1
Sequence:CCGGCCTACTTTGAAGGAGAAAGAACTCGAGTTCTTTCTCCTTCAAAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_006159.1-383s1c1
Sequence:CCGGCCCACTTAAATTCAGGAGTTACTCGAGTAACTCCTGAATTTAAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006159.1-1952s1c1
Sequence:CCGGGCTTCAATTTGGATGGCGGATCTCGAGATCCGCCATCCAAATTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_006159.1-176s1c1
Sequence:CCGGCCCTACAGATTGACGTCTTAACTCGAGTTAAGACGTCAATCTGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006159.2-1897s21c1
Sequence:CCGGATGTGACAGTCGTGCTAATTGCTCGAGCAATTAGCACGACTGTCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006159.2-1046s21c1
Sequence:CCGGCGAGAATTTGAGTCCTGGATACTCGAGTATCCAGGACTCAAATTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006159.2-1221s21c1
Sequence:CCGGCCTACTTTGAAGGAGAAAGAACTCGAGTTCTTTCTCCTTCAAAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006159.2-2058s21c1
Sequence:CCGGGCTTCAATTTGGATGGCGGATCTCGAGATCCGCCATCCAAATTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006159.2-3080s21c1
Sequence:CCGGGTAAAGCAAAGAAGCTATAACCTCGAGGTTATAGCTTCTTTGCTTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006159
VALIDATED
NELL2 MISSION shRNA Lentiviral Transduction Particles
NEL-like 2 (chicken)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006159.1-940s1c1
Sequence:CCGGCGAGAATTTGAGTCCTGGATACTCGAGTATCCAGGACTCAAATTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006159.1-1115s1c1
Sequence:CCGGCCTACTTTGAAGGAGAAAGAACTCGAGTTCTTTCTCCTTCAAAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_006159.1-383s1c1
Sequence:CCGGCCCACTTAAATTCAGGAGTTACTCGAGTAACTCCTGAATTTAAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006159.1-1952s1c1
Sequence:CCGGGCTTCAATTTGGATGGCGGATCTCGAGATCCGCCATCCAAATTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_006159.1-176s1c1
Sequence:CCGGCCCTACAGATTGACGTCTTAACTCGAGTTAAGACGTCAATCTGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006159.2-1897s21c1
Sequence:CCGGATGTGACAGTCGTGCTAATTGCTCGAGCAATTAGCACGACTGTCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006159.2-1046s21c1
Sequence:CCGGCGAGAATTTGAGTCCTGGATACTCGAGTATCCAGGACTCAAATTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006159.2-1221s21c1
Sequence:CCGGCCTACTTTGAAGGAGAAAGAACTCGAGTTCTTTCTCCTTCAAAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006159.2-2058s21c1
Sequence:CCGGGCTTCAATTTGGATGGCGGATCTCGAGATCCGCCATCCAAATTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006159.2-3080s21c1
Sequence:CCGGGTAAAGCAAAGAAGCTATAACCTCGAGGTTATAGCTTCTTTGCTTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016743
NELL2 MISSION shRNA Bacterial Glycerol Stock
NEL-like 2 (chicken)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016743.1-1841s1c1
Sequence:CCGGGCGGAGAATCCTGTGAAGATACTCGAGTATCTTCACAGGATTCTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016743.1-739s1c1
Sequence:CCGGCCAACATGCAACGACTTCCATCTCGAGATGGAAGTCGTTGCATGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016743.2-342s1c1
Sequence:CCGGCCCTACAGATTGACGTCTTAACTCGAGTTAAGACGTCAATCTGTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016743.2-550s1c1
Sequence:CCGGCCACTTAAATTCGGGAGTTATCTCGAGATAACTCCCGAATTTAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016743.2-674s21c1
Sequence:CCGGACGGAAGTGTTTCCTTATATTCTCGAGAATATAAGGAAACACTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016743.2-3114s21c1
Sequence:CCGGACAGCGGTGAGCGAGTTATATCTCGAGATATAACTCGCTCACCGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016743.2-342s21c1
Sequence:CCGGCCCTACAGATTGACGTCTTAACTCGAGTTAAGACGTCAATCTGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016743.2-550s21c1
Sequence:CCGGCCACTTAAATTCGGGAGTTATCTCGAGATAACTCCCGAATTTAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016743
NELL2 MISSION shRNA shRNA Plasmid DNA
NEL-like 2 (chicken)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016743.1-1841s1c1
Sequence:CCGGGCGGAGAATCCTGTGAAGATACTCGAGTATCTTCACAGGATTCTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016743.1-739s1c1
Sequence:CCGGCCAACATGCAACGACTTCCATCTCGAGATGGAAGTCGTTGCATGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016743.2-342s1c1
Sequence:CCGGCCCTACAGATTGACGTCTTAACTCGAGTTAAGACGTCAATCTGTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016743.2-550s1c1
Sequence:CCGGCCACTTAAATTCGGGAGTTATCTCGAGATAACTCCCGAATTTAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016743.2-674s21c1
Sequence:CCGGACGGAAGTGTTTCCTTATATTCTCGAGAATATAAGGAAACACTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016743.2-3114s21c1
Sequence:CCGGACAGCGGTGAGCGAGTTATATCTCGAGATATAACTCGCTCACCGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016743.2-342s21c1
Sequence:CCGGCCCTACAGATTGACGTCTTAACTCGAGTTAAGACGTCAATCTGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016743.2-550s21c1
Sequence:CCGGCCACTTAAATTCGGGAGTTATCTCGAGATAACTCCCGAATTTAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016743
NELL2 MISSION shRNA Lentiviral Transduction Particles
NEL-like 2 (chicken)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016743.1-1841s1c1
Sequence:CCGGGCGGAGAATCCTGTGAAGATACTCGAGTATCTTCACAGGATTCTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016743.1-739s1c1
Sequence:CCGGCCAACATGCAACGACTTCCATCTCGAGATGGAAGTCGTTGCATGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016743.2-342s1c1
Sequence:CCGGCCCTACAGATTGACGTCTTAACTCGAGTTAAGACGTCAATCTGTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016743.2-550s1c1
Sequence:CCGGCCACTTAAATTCGGGAGTTATCTCGAGATAACTCCCGAATTTAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016743.2-674s21c1
Sequence:CCGGACGGAAGTGTTTCCTTATATTCTCGAGAATATAAGGAAACACTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016743.2-3114s21c1
Sequence:CCGGACAGCGGTGAGCGAGTTATATCTCGAGATATAACTCGCTCACCGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016743.2-342s21c1
Sequence:CCGGCCCTACAGATTGACGTCTTAACTCGAGTTAAGACGTCAATCTGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016743.2-550s21c1
Sequence:CCGGCCACTTAAATTCGGGAGTTATCTCGAGATAACTCCCGAATTTAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)