EMAIL THIS PAGE TO A FRIEND

NEMF

nuclear export mediator factor

45 Gene Product Result for
Synonyms: NY-CO-1 SDCCAG1
Gene ID:
Mouse(66244) nuclear export mediator factor
Rat(100322884) nuclear export mediator factor
chicken(428926) nuclear export mediator factor
dog(490678) nuclear export mediator factor
domestic cat(101093444) nuclear export mediator factor
cow(541292) nuclear export mediator factor
Horse(100065895) nuclear export mediator factor
sheep(101101894) nuclear export mediator factor
naked mole-rat(101703766) nuclear export mediator factor
Domestic Rabbit(100349946) nuclear export mediator factor
domestic guinea pig(100725852) nuclear export mediator factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025441 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025441 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025441 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004713 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004713 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004713 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181665 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181665 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181665 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004713 Rosetta Predictions human pricing
NM_025441 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004713 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042433 predicted 592
2 SASI_Hs02_00338175 predicted 317
3 SASI_Hs01_00042435 predicted 3196
4 SASI_Hs01_00042436 predicted 472
5 SASI_Hs01_00042437 predicted 2057
6 SASI_Hs01_00042438 predicted 381
7 SASI_Hs01_00042439 predicted 384
8 SASI_Hs01_00042440 predicted 1129
9 SASI_Hs01_00042441 predicted 436
10 SASI_Hs02_00338176 predicted 641
11 SASI_Hs01_00042432 predicted 1712
12 SASI_Hs01_00042434 predicted 2386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025441 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328268 predicted 2109
2 SASI_Mm01_00142982 predicted 598
3 SASI_Mm01_00142983 predicted 660
4 SASI_Mm02_00328269 predicted 301
5 SASI_Mm01_00142984 predicted 425
6 SASI_Mm01_00142985 predicted 580
7 SASI_Mm01_00142987 predicted 541
8 SASI_Mm01_00142988 predicted 2045
9 SASI_Mm01_00142989 predicted 380
10 SASI_Mm01_00142990 predicted 639
11 SASI_Mm01_00142986 predicted 915
12 SASI_Mm01_00142991 predicted 782
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025441
NEMF MISSION shRNA Bacterial Glycerol Stock
nuclear export mediator factor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025441.2-120s21c1
Sequence:CCGGGCTAGGAATGAGAGTAAACAACTCGAGTTGTTTACTCTCATTCCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025441.2-3303s21c1
Sequence:CCGGTCAACGATGCAGACGTGTTAACTCGAGTTAACACGTCTGCATCGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025441.2-379s21c1
Sequence:CCGGGCTGCTTATCACTTAATCATTCTCGAGAATGATTAAGTGATAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025441.2-782s21c1
Sequence:CCGGTCAATGGAAAGGGCTATATAACTCGAGTTATATAGCCCTTTCCATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025441.2-151s21c1
Sequence:CCGGGTGGATAACAAGACATATCTTCTCGAGAAGATATGTCTTGTTATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025441
NEMF MISSION shRNA shRNA Plasmid DNA
nuclear export mediator factor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025441.2-120s21c1
Sequence:CCGGGCTAGGAATGAGAGTAAACAACTCGAGTTGTTTACTCTCATTCCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025441.2-3303s21c1
Sequence:CCGGTCAACGATGCAGACGTGTTAACTCGAGTTAACACGTCTGCATCGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025441.2-379s21c1
Sequence:CCGGGCTGCTTATCACTTAATCATTCTCGAGAATGATTAAGTGATAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025441.2-782s21c1
Sequence:CCGGTCAATGGAAAGGGCTATATAACTCGAGTTATATAGCCCTTTCCATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025441.2-151s21c1
Sequence:CCGGGTGGATAACAAGACATATCTTCTCGAGAAGATATGTCTTGTTATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025441
NEMF MISSION shRNA Lentiviral Transduction Particles
nuclear export mediator factor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025441.2-120s21c1
Sequence:CCGGGCTAGGAATGAGAGTAAACAACTCGAGTTGTTTACTCTCATTCCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025441.2-3303s21c1
Sequence:CCGGTCAACGATGCAGACGTGTTAACTCGAGTTAACACGTCTGCATCGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025441.2-379s21c1
Sequence:CCGGGCTGCTTATCACTTAATCATTCTCGAGAATGATTAAGTGATAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025441.2-782s21c1
Sequence:CCGGTCAATGGAAAGGGCTATATAACTCGAGTTATATAGCCCTTTCCATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025441.2-151s21c1
Sequence:CCGGGTGGATAACAAGACATATCTTCTCGAGAAGATATGTCTTGTTATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004713
NEMF MISSION shRNA Bacterial Glycerol Stock
nuclear export mediator factor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000151021    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004713.2-3375s1c1
Sequence:CCGGGTATCAGGATTTCCGCATTATCTCGAGATAATGCGGAAATCCTGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004713.2-1181s1c1
Sequence:CCGGCCAGATAGATTGGACAGAAATCTCGAGATTTCTGTCCAATCTATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004713.2-1292s1c1
Sequence:CCGGGCTGCTAAGAAATCCATACTTCTCGAGAAGTATGGATTTCTTAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004713.2-3211s1c1
Sequence:CCGGGCAGCGTAAAGGACACAGATTCTCGAGAATCTGTGTCCTTTACGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004713.2-3267s1c1
Sequence:CCGGGCACCCAATCTTCTGAACGTACTCGAGTACGTTCAGAAGATTGGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004713.2-3357s1c1
Sequence:CCGGCAAAGATGAAAGCACCATGTACTCGAGTACATGGTGCTTTCATCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004713.2-265s1c1
Sequence:CCGGCTAAGAATATGATGCCGTCTACTCGAGTAGACGGCATCATATTCTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004713.2-199s1c1
Sequence:CCGGCGGACTTTAAAGCTACACTTTCTCGAGAAAGTGTAGCTTTAAAGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004713.2-131s1c1
Sequence:CCGGGCTAGGAATGAGAGTAAACAACTCGAGTTGTTTACTCTCATTCCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004713
NEMF MISSION shRNA shRNA Plasmid DNA
nuclear export mediator factor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000151021    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004713.2-3375s1c1
Sequence:CCGGGTATCAGGATTTCCGCATTATCTCGAGATAATGCGGAAATCCTGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004713.2-1181s1c1
Sequence:CCGGCCAGATAGATTGGACAGAAATCTCGAGATTTCTGTCCAATCTATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004713.2-1292s1c1
Sequence:CCGGGCTGCTAAGAAATCCATACTTCTCGAGAAGTATGGATTTCTTAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004713.2-3211s1c1
Sequence:CCGGGCAGCGTAAAGGACACAGATTCTCGAGAATCTGTGTCCTTTACGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004713.2-3267s1c1
Sequence:CCGGGCACCCAATCTTCTGAACGTACTCGAGTACGTTCAGAAGATTGGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004713.2-3357s1c1
Sequence:CCGGCAAAGATGAAAGCACCATGTACTCGAGTACATGGTGCTTTCATCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004713.2-265s1c1
Sequence:CCGGCTAAGAATATGATGCCGTCTACTCGAGTAGACGGCATCATATTCTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004713.2-199s1c1
Sequence:CCGGCGGACTTTAAAGCTACACTTTCTCGAGAAAGTGTAGCTTTAAAGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004713.2-131s1c1
Sequence:CCGGGCTAGGAATGAGAGTAAACAACTCGAGTTGTTTACTCTCATTCCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004713
NEMF MISSION shRNA Lentiviral Transduction Particles
nuclear export mediator factor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000151021    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004713.2-3375s1c1
Sequence:CCGGGTATCAGGATTTCCGCATTATCTCGAGATAATGCGGAAATCCTGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004713.2-1181s1c1
Sequence:CCGGCCAGATAGATTGGACAGAAATCTCGAGATTTCTGTCCAATCTATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004713.2-1292s1c1
Sequence:CCGGGCTGCTAAGAAATCCATACTTCTCGAGAAGTATGGATTTCTTAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004713.2-3211s1c1
Sequence:CCGGGCAGCGTAAAGGACACAGATTCTCGAGAATCTGTGTCCTTTACGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004713.2-3267s1c1
Sequence:CCGGGCACCCAATCTTCTGAACGTACTCGAGTACGTTCAGAAGATTGGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004713.2-3357s1c1
Sequence:CCGGCAAAGATGAAAGCACCATGTACTCGAGTACATGGTGCTTTCATCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004713.2-265s1c1
Sequence:CCGGCTAAGAATATGATGCCGTCTACTCGAGTAGACGGCATCATATTCTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004713.2-199s1c1
Sequence:CCGGCGGACTTTAAAGCTACACTTTCTCGAGAAAGTGTAGCTTTAAAGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004713.2-131s1c1
Sequence:CCGGGCTAGGAATGAGAGTAAACAACTCGAGTTGTTTACTCTCATTCCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181665
VALIDATED
NEMF MISSION shRNA Bacterial Glycerol Stock
nuclear export mediator factor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181665.1-1313s1c1
Sequence:CCGGGCCAGCATTGAGAACAGTGATCTCGAGATCACTGTTCTCAATGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181665.1-379s1c1
Sequence:CCGGGCTGCTTATCACTTAATCATTCTCGAGAATGATTAAGTGATAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181665.1-847s1c1
Sequence:CCGGGCTGAAGACATACTCACGTATCTCGAGATACGTGAGTATGTCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181665.1-151s1c1
Sequence:CCGGGTGGATAACAAGACATATCTTCTCGAGAAGATATGTCTTGTTATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181665.1-120s1c1
Sequence:CCGGGCTAGGAATGAGAGTAAACAACTCGAGTTGTTTACTCTCATTCCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181665
VALIDATED
NEMF MISSION shRNA shRNA Plasmid DNA
nuclear export mediator factor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181665.1-1313s1c1
Sequence:CCGGGCCAGCATTGAGAACAGTGATCTCGAGATCACTGTTCTCAATGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181665.1-379s1c1
Sequence:CCGGGCTGCTTATCACTTAATCATTCTCGAGAATGATTAAGTGATAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181665.1-847s1c1
Sequence:CCGGGCTGAAGACATACTCACGTATCTCGAGATACGTGAGTATGTCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181665.1-151s1c1
Sequence:CCGGGTGGATAACAAGACATATCTTCTCGAGAAGATATGTCTTGTTATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181665.1-120s1c1
Sequence:CCGGGCTAGGAATGAGAGTAAACAACTCGAGTTGTTTACTCTCATTCCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181665
VALIDATED
NEMF MISSION shRNA Lentiviral Transduction Particles
nuclear export mediator factor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181665.1-1313s1c1
Sequence:CCGGGCCAGCATTGAGAACAGTGATCTCGAGATCACTGTTCTCAATGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181665.1-379s1c1
Sequence:CCGGGCTGCTTATCACTTAATCATTCTCGAGAATGATTAAGTGATAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181665.1-847s1c1
Sequence:CCGGGCTGAAGACATACTCACGTATCTCGAGATACGTGAGTATGTCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181665.1-151s1c1
Sequence:CCGGGTGGATAACAAGACATATCTTCTCGAGAAGATATGTCTTGTTATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181665.1-120s1c1
Sequence:CCGGGCTAGGAATGAGAGTAAACAACTCGAGTTGTTTACTCTCATTCCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)