EMAIL THIS PAGE TO A FRIEND

NENF

neudesin neurotrophic factor

54 Gene Product Result for
Synonyms: CIR2 SCIRP10 SPUF
UniProtKB ID: Q9UMX5, A1KYQ8, Q53FZ6, Q5TM90
Gene ID:
Human(29937) Summary: This gene encodes a neurotrophic factor that may play a role in neuron differentiation and development. A pseudogene of this gene is found on chromosome 12. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2009]
Mouse(66208) neuron derived neurotrophic factor
Rat(289380) neudesin neurotrophic factor
Zebrafish(571299) neuron derived neurotrophic factor
domestic cat(101083478) neudesin neurotrophic factor
cow(616334) neudesin neurotrophic factor
dog(480022) neudesin neurotrophic factor
chicken(421370) neudesin neurotrophic factor
domestic guinea pig(100722650) neudesin neurotrophic factor
naked mole-rat(101713607) neudesin neurotrophic factor
sheep(101103662) neudesin neurotrophic factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013349 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013349 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013349 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025424 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025424 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025424 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013349 Rosetta Predictions human pricing
NM_001002851 Rosetta Predictions rat pricing
NM_025424 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230088 predicted 299
2 SASI_Hs01_00230090 predicted 431
3 SASI_Hs01_00230091 predicted 422
4 SASI_Hs01_00230092 predicted 430
5 SASI_Hs02_00344664 predicted 417
6 SASI_Hs01_00230093 predicted 433
7 SASI_Hs01_00230094 predicted 449
8 SASI_Hs02_00344665 predicted 428
9 SASI_Hs02_00344666 predicted 436
10 SASI_Hs01_00230096 predicted 330
11 SASI_Hs01_00230089 predicted 461
12 SASI_Hs01_00230095 predicted 400
13 SASI_Hs01_00230097 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002851 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053257 predicted 403
2 SASI_Rn02_00198024 predicted 330
3 SASI_Rn01_00053258 predicted 327
4 SASI_Rn01_00053259 predicted 193
5 SASI_Rn01_00053260 predicted 342
6 SASI_Rn01_00053261 predicted 195
7 SASI_Rn01_00053262 predicted 405
8 SASI_Rn01_00053263 predicted 336
9 SASI_Rn01_00053264 predicted 228
10 SASI_Rn01_00053265 predicted 322
11 SASI_Rn01_00053266 predicted 222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025424 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027693 predicted 341
2 SASI_Mm01_00027694 predicted 203
3 SASI_Mm01_00027695 predicted 204
4 SASI_Mm01_00027697 predicted 228
5 SASI_Mm01_00027698 predicted 221
6 SASI_Mm01_00027699 predicted 361
7 SASI_Mm01_00027700 predicted 224
8 SASI_Mm01_00027701 predicted 347
9 SASI_Mm01_00027702 predicted 322
10 SASI_Mm02_00328222 predicted 394
11 SASI_Mm01_00027696 predicted 411
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013349
NENF MISSION shRNA Bacterial Glycerol Stock
neudesin neurotrophic factor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155586    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013349.3-722s1c1
Sequence:CCGGCCAGGGATCAATAAGAGCCAACTCGAGTTGGCTCTTATTGATCCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013349.3-388s1c1
Sequence:CCGGGTCTTCACCAAAGTGTACAAACTCGAGTTTGTACACTTTGGTGAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013349.4-258s21c1
Sequence:CCGGAGTGAAGGGAGTGGTGTTTGACTCGAGTCAAACACCACTCCCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013349.4-381s21c1
Sequence:CCGGAGACCTCACCCATGACACTACCTCGAGGTAGTGTCATGGGTGAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013349.4-235s21c1
Sequence:CCGGGAAGATCAGCCCATCTACTTGCTCGAGCAAGTAGATGGGCTGATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013349.3-222s1c1
Sequence:CCGGGTTTGATGTCACCTCCGGAAACTCGAGTTTCCGGAGGTGACATCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013349.3-655s1c1
Sequence:CCGGGAAGAGCAAATGCCTCCTGTTCTCGAGAACAGGAGGCATTTGCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013349.3-385s1c1
Sequence:CCGGGAGGTCTTCACCAAAGTGTACCTCGAGGTACACTTTGGTGAAGACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013349.3-379s1c1
Sequence:CCGGCTGGATGAGGTCTTCACCAAACTCGAGTTTGGTGAAGACCTCATCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013349
NENF MISSION shRNA shRNA Plasmid DNA
neudesin neurotrophic factor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155586    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013349.3-722s1c1
Sequence:CCGGCCAGGGATCAATAAGAGCCAACTCGAGTTGGCTCTTATTGATCCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013349.3-388s1c1
Sequence:CCGGGTCTTCACCAAAGTGTACAAACTCGAGTTTGTACACTTTGGTGAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013349.4-258s21c1
Sequence:CCGGAGTGAAGGGAGTGGTGTTTGACTCGAGTCAAACACCACTCCCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013349.4-381s21c1
Sequence:CCGGAGACCTCACCCATGACACTACCTCGAGGTAGTGTCATGGGTGAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013349.4-235s21c1
Sequence:CCGGGAAGATCAGCCCATCTACTTGCTCGAGCAAGTAGATGGGCTGATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013349.3-222s1c1
Sequence:CCGGGTTTGATGTCACCTCCGGAAACTCGAGTTTCCGGAGGTGACATCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013349.3-655s1c1
Sequence:CCGGGAAGAGCAAATGCCTCCTGTTCTCGAGAACAGGAGGCATTTGCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013349.3-385s1c1
Sequence:CCGGGAGGTCTTCACCAAAGTGTACCTCGAGGTACACTTTGGTGAAGACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013349.3-379s1c1
Sequence:CCGGCTGGATGAGGTCTTCACCAAACTCGAGTTTGGTGAAGACCTCATCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013349
NENF MISSION shRNA Lentiviral Transduction Particles
neudesin neurotrophic factor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155586    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013349.3-722s1c1
Sequence:CCGGCCAGGGATCAATAAGAGCCAACTCGAGTTGGCTCTTATTGATCCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013349.3-388s1c1
Sequence:CCGGGTCTTCACCAAAGTGTACAAACTCGAGTTTGTACACTTTGGTGAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013349.4-258s21c1
Sequence:CCGGAGTGAAGGGAGTGGTGTTTGACTCGAGTCAAACACCACTCCCTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013349.4-381s21c1
Sequence:CCGGAGACCTCACCCATGACACTACCTCGAGGTAGTGTCATGGGTGAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013349.4-235s21c1
Sequence:CCGGGAAGATCAGCCCATCTACTTGCTCGAGCAAGTAGATGGGCTGATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013349.3-222s1c1
Sequence:CCGGGTTTGATGTCACCTCCGGAAACTCGAGTTTCCGGAGGTGACATCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013349.3-655s1c1
Sequence:CCGGGAAGAGCAAATGCCTCCTGTTCTCGAGAACAGGAGGCATTTGCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013349.3-385s1c1
Sequence:CCGGGAGGTCTTCACCAAAGTGTACCTCGAGGTACACTTTGGTGAAGACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013349.3-379s1c1
Sequence:CCGGCTGGATGAGGTCTTCACCAAACTCGAGTTTGGTGAAGACCTCATCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025424
VALIDATED
NENF MISSION shRNA Bacterial Glycerol Stock
neudesin neurotrophic factor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025424.2-406s21c1
Sequence:CCGGTCTTCAGCAAGGTGTACAAAGCTCGAGCTTTGTACACCTTGCTGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025424.2-201s21c1
Sequence:CCGGGAGGATCAGCCCATCTACTTGCTCGAGCAAGTAGATGGGCTGATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025424.2-322s21c1
Sequence:CCGGTGGCCAAGATGTCACTGGATCCTCGAGGATCCAGTGACATCTTGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025424.2-346s21c1
Sequence:CCGGCAGACCTCACTCACGACACTACTCGAGTAGTGTCGTGAGTGAGGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025424.2-227s21c1
Sequence:CCGGGAAGGGAGTGGTGTTCGATGTCTCGAGACATCGAACACCACTCCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025424
VALIDATED
NENF MISSION shRNA shRNA Plasmid DNA
neudesin neurotrophic factor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025424.2-406s21c1
Sequence:CCGGTCTTCAGCAAGGTGTACAAAGCTCGAGCTTTGTACACCTTGCTGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025424.2-201s21c1
Sequence:CCGGGAGGATCAGCCCATCTACTTGCTCGAGCAAGTAGATGGGCTGATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025424.2-322s21c1
Sequence:CCGGTGGCCAAGATGTCACTGGATCCTCGAGGATCCAGTGACATCTTGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025424.2-346s21c1
Sequence:CCGGCAGACCTCACTCACGACACTACTCGAGTAGTGTCGTGAGTGAGGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025424.2-227s21c1
Sequence:CCGGGAAGGGAGTGGTGTTCGATGTCTCGAGACATCGAACACCACTCCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025424
VALIDATED
NENF MISSION shRNA Lentiviral Transduction Particles
neudesin neurotrophic factor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025424.2-406s21c1
Sequence:CCGGTCTTCAGCAAGGTGTACAAAGCTCGAGCTTTGTACACCTTGCTGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025424.2-201s21c1
Sequence:CCGGGAGGATCAGCCCATCTACTTGCTCGAGCAAGTAGATGGGCTGATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025424.2-322s21c1
Sequence:CCGGTGGCCAAGATGTCACTGGATCCTCGAGGATCCAGTGACATCTTGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025424.2-346s21c1
Sequence:CCGGCAGACCTCACTCACGACACTACTCGAGTAGTGTCGTGAGTGAGGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025424.2-227s21c1
Sequence:CCGGGAAGGGAGTGGTGTTCGATGTCTCGAGACATCGAACACCACTCCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)