EMAIL THIS PAGE TO A FRIEND

NEO1

neogenin 1

143 Gene Product Result for
Synonyms: IGDCC2 NGN
UniProtKB ID: Q92859, B7ZKM9, B7ZKN0, O00340, Q17RX1
Gene ID:
Human(4756) Summary: This gene encodes a cell surface protein that is a member of the immunoglobulin superfamily. The encoded protein consists of four N-terminal immunoglobulin-like domains, six fibronectin type III domains, a transmembrane domain and a C-terminal internal domain that shares homology with the tumor suppressor candidate gene DCC. This protein may be involved in cell growth and differentiation and in cell-cell adhesion. Defects in this gene are associated with cell proliferation in certain cancers. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
Mouse(18007) neogenin
Rat(81735) neogenin 1
Zebrafish(266983) neogenin 1
cow(100297058) neogenin 1
cow(535307) neogenin 1
Horse(100063194) neogenin 1
dog(487635) neogenin 1
chicken(395822) neogenin 1
sheep(101117081) neogenin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008684 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008684 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008684 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002499 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002499 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002499 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU061751 MISSION® esiRNA esiRNA human NEO1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002499 Rosetta Predictions human pricing
XM_001074913 Rosetta Predictions rat pricing
XM_343402 Rosetta Predictions rat pricing
NM_001042752 Rosetta Predictions mouse pricing
NM_008684 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002499 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333957 predicted 3686
2 SASI_Hs01_00151269 predicted 1760
3 SASI_Hs01_00151270 predicted 3755
4 SASI_Hs01_00151271 predicted 4480
5 SASI_Hs01_00151273 predicted 2737
6 SASI_Hs01_00151274 predicted 956
7 SASI_Hs01_00151276 predicted 3393
8 SASI_Hs01_00151277 predicted 1575
9 SASI_Hs01_00151275 predicted 3056
10 SASI_Hs02_00333958 predicted 2139
11 SASI_Hs01_00151268 predicted 3544
12 SASI_Hs01_00151272 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074913 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00347705 predicted 3371
2 SASI_Rn02_00347706 predicted 572
3 SASI_Rn02_00347707 predicted 414
4 SASI_Rn02_00347708 predicted 1875
5 SASI_Rn02_00347709 predicted 1961
6 SASI_Rn02_00347710 predicted 1949
7 SASI_Rn02_00347711 predicted 925
8 SASI_Rn02_00347712 predicted 2556
9 SASI_Rn02_00347713 predicted 3926
10 SASI_Rn02_00347714 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343402 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395734 predicted 3371
2 SASI_Rn02_00395735 predicted 574
3 SASI_Rn02_00395736 predicted 410
4 SASI_Rn02_00395737 predicted 1870
5 SASI_Rn02_00395738 predicted 1953
6 SASI_Rn02_00395739 predicted 1946
7 SASI_Rn02_00395740 predicted 927
8 SASI_Rn02_00395741 predicted 2552
9 SASI_Rn02_00395742 predicted 3924
10 SASI_Rn02_00395743 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042752 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291095 predicted 961
2 SASI_Mm02_00291096 predicted 3927
3 SASI_Mm02_00291097 predicted 3728
4 SASI_Mm02_00291098 predicted 2406
5 SASI_Mm02_00291099 predicted 2030
6 SASI_Mm02_00291100 predicted 842
7 SASI_Mm02_00291101 predicted 4679
8 SASI_Mm02_00291102 predicted 3854
9 SASI_Mm02_00291103 predicted 869
10 SASI_Mm02_00291104 predicted 4737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008684 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314474 predicted 955
2 SASI_Mm02_00314475 predicted 4000
3 SASI_Mm01_00098024 predicted 3810
4 SASI_Mm01_00098025 predicted 2400
5 SASI_Mm01_00098026 predicted 2030
6 SASI_Mm01_00098027 predicted 847
7 SASI_Mm02_00314476 predicted 4757
8 SASI_Mm01_00098028 predicted 3934
9 SASI_Mm02_00314477 predicted 869
10 SASI_Mm02_00314478 predicted 4822
11 SASI_Mm01_00098023 predicted 2642
12 SASI_Mm01_00098029 predicted 2636
13 SASI_Mm01_00098030 predicted 2888
14 SASI_Mm01_00098031 predicted 1250
15 SASI_Mm01_00098032 predicted 4260
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008684
VALIDATED
NEO1 MISSION shRNA Bacterial Glycerol Stock
neogenin 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008684.2-2315s21c1
Sequence:CCGGCCTCAGAATCTGTCCTTAGAACTCGAGTTCTAAGGACAGATTCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008684.2-1282s21c1
Sequence:CCGGGGATGATGCTGGGACTTATTTCTCGAGAAATAAGTCCCAGCATCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008684.2-2767s21c1
Sequence:CCGGGGACTATAAACAACGTTATTACTCGAGTAATAACGTTGTTTATAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008684.2-5142s21c1
Sequence:CCGGAGTGTAGACATTGGCATTTATCTCGAGATAAATGCCAATGTCTACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008684.2-653s21c1
Sequence:CCGGCTACTCCCAGATGGATCTTTACTCGAGTAAAGATCCATCTGGGAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008684.1-2970s1c1
Sequence:CCGGCCCAGCAAACACGAAGTACAACTCGAGTTGTACTTCGTGTTTGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008684.1-3014s1c1
Sequence:CCGGGCTATTTGGTTACTGGTTTAACTCGAGTTAAACCAGTAACCAAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008684.1-2182s1c1
Sequence:CCGGCCTCAGAATCTGTCCTTAGAACTCGAGTTCTAAGGACAGATTCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008684.1-3843s1c1
Sequence:CCGGCCCTCGAAACTCTCAAGATATCTCGAGATATCTTGAGAGTTTCGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008684.1-4977s1c1
Sequence:CCGGGCTTGTGTCTTTGTGCTGCAACTCGAGTTGCAGCACAAAGACACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008684
VALIDATED
NEO1 MISSION shRNA shRNA Plasmid DNA
neogenin 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008684.2-2315s21c1
Sequence:CCGGCCTCAGAATCTGTCCTTAGAACTCGAGTTCTAAGGACAGATTCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008684.2-1282s21c1
Sequence:CCGGGGATGATGCTGGGACTTATTTCTCGAGAAATAAGTCCCAGCATCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008684.2-2767s21c1
Sequence:CCGGGGACTATAAACAACGTTATTACTCGAGTAATAACGTTGTTTATAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008684.2-5142s21c1
Sequence:CCGGAGTGTAGACATTGGCATTTATCTCGAGATAAATGCCAATGTCTACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008684.2-653s21c1
Sequence:CCGGCTACTCCCAGATGGATCTTTACTCGAGTAAAGATCCATCTGGGAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008684.1-2970s1c1
Sequence:CCGGCCCAGCAAACACGAAGTACAACTCGAGTTGTACTTCGTGTTTGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008684.1-3014s1c1
Sequence:CCGGGCTATTTGGTTACTGGTTTAACTCGAGTTAAACCAGTAACCAAATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008684.1-2182s1c1
Sequence:CCGGCCTCAGAATCTGTCCTTAGAACTCGAGTTCTAAGGACAGATTCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008684.1-3843s1c1
Sequence:CCGGCCCTCGAAACTCTCAAGATATCTCGAGATATCTTGAGAGTTTCGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008684.1-4977s1c1
Sequence:CCGGGCTTGTGTCTTTGTGCTGCAACTCGAGTTGCAGCACAAAGACACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008684
VALIDATED
NEO1 MISSION shRNA Lentiviral Transduction Particles
neogenin 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008684.2-2315s21c1
Sequence:CCGGCCTCAGAATCTGTCCTTAGAACTCGAGTTCTAAGGACAGATTCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008684.2-1282s21c1
Sequence:CCGGGGATGATGCTGGGACTTATTTCTCGAGAAATAAGTCCCAGCATCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008684.2-2767s21c1
Sequence:CCGGGGACTATAAACAACGTTATTACTCGAGTAATAACGTTGTTTATAGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008684.2-5142s21c1
Sequence:CCGGAGTGTAGACATTGGCATTTATCTCGAGATAAATGCCAATGTCTACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008684.2-653s21c1
Sequence:CCGGCTACTCCCAGATGGATCTTTACTCGAGTAAAGATCCATCTGGGAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008684.1-2970s1c1
Sequence:CCGGCCCAGCAAACACGAAGTACAACTCGAGTTGTACTTCGTGTTTGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008684.1-3014s1c1
Sequence:CCGGGCTATTTGGTTACTGGTTTAACTCGAGTTAAACCAGTAACCAAATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008684.1-2182s1c1
Sequence:CCGGCCTCAGAATCTGTCCTTAGAACTCGAGTTCTAAGGACAGATTCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008684.1-3843s1c1
Sequence:CCGGCCCTCGAAACTCTCAAGATATCTCGAGATATCTTGAGAGTTTCGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008684.1-4977s1c1
Sequence:CCGGGCTTGTGTCTTTGTGCTGCAACTCGAGTTGCAGCACAAAGACACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002499
VALIDATED
NEO1 MISSION shRNA Bacterial Glycerol Stock
neogenin 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002499.2-4865s21c1
Sequence:CCGGGCATCACCTTTATGGAGTGTACTCGAGTACACTCCATAAAGGTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002499.2-2839s21c1
Sequence:CCGGCCCAGCAAACACCAAGTACAACTCGAGTTGTACTTGGTGTTTGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002499.2-1409s21c1
Sequence:CCGGGCCCAACTGATAATCCTTGAACTCGAGTTCAAGGATTATCAGTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002499.1-2833s1c1
Sequence:CCGGCCCAGCAAACACCAAGTACAACTCGAGTTGTACTTGGTGTTTGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002499.1-2982s1c1
Sequence:CCGGCCTTTGAATTAGTTCCGACTTCTCGAGAAGTCGGAACTAATTCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002499.1-312s1c1
Sequence:CCGGCGGTGGATACACTCTCAGTTACTCGAGTAACTGAGAGTGTATCCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002499.2-318s21c1
Sequence:CCGGCGGTGGATACACTCTCAGTTACTCGAGTAACTGAGAGTGTATCCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002499.1-4860s1c1
Sequence:CCGGGCATCACCTTTATGGAGTGTACTCGAGTACACTCCATAAAGGTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002499.1-1403s1c1
Sequence:CCGGGCCCAACTGATAATCCTTGAACTCGAGTTCAAGGATTATCAGTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002499
VALIDATED
NEO1 MISSION shRNA shRNA Plasmid DNA
neogenin 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002499.2-4865s21c1
Sequence:CCGGGCATCACCTTTATGGAGTGTACTCGAGTACACTCCATAAAGGTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002499.2-2839s21c1
Sequence:CCGGCCCAGCAAACACCAAGTACAACTCGAGTTGTACTTGGTGTTTGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002499.2-1409s21c1
Sequence:CCGGGCCCAACTGATAATCCTTGAACTCGAGTTCAAGGATTATCAGTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002499.1-2833s1c1
Sequence:CCGGCCCAGCAAACACCAAGTACAACTCGAGTTGTACTTGGTGTTTGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002499.1-2982s1c1
Sequence:CCGGCCTTTGAATTAGTTCCGACTTCTCGAGAAGTCGGAACTAATTCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002499.1-312s1c1
Sequence:CCGGCGGTGGATACACTCTCAGTTACTCGAGTAACTGAGAGTGTATCCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002499.2-318s21c1
Sequence:CCGGCGGTGGATACACTCTCAGTTACTCGAGTAACTGAGAGTGTATCCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002499.1-4860s1c1
Sequence:CCGGGCATCACCTTTATGGAGTGTACTCGAGTACACTCCATAAAGGTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002499.1-1403s1c1
Sequence:CCGGGCCCAACTGATAATCCTTGAACTCGAGTTCAAGGATTATCAGTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002499
VALIDATED
NEO1 MISSION shRNA Lentiviral Transduction Particles
neogenin 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002499.2-4865s21c1
Sequence:CCGGGCATCACCTTTATGGAGTGTACTCGAGTACACTCCATAAAGGTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002499.2-2839s21c1
Sequence:CCGGCCCAGCAAACACCAAGTACAACTCGAGTTGTACTTGGTGTTTGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002499.2-1409s21c1
Sequence:CCGGGCCCAACTGATAATCCTTGAACTCGAGTTCAAGGATTATCAGTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002499.1-2833s1c1
Sequence:CCGGCCCAGCAAACACCAAGTACAACTCGAGTTGTACTTGGTGTTTGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002499.1-2982s1c1
Sequence:CCGGCCTTTGAATTAGTTCCGACTTCTCGAGAAGTCGGAACTAATTCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002499.1-312s1c1
Sequence:CCGGCGGTGGATACACTCTCAGTTACTCGAGTAACTGAGAGTGTATCCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002499.2-318s21c1
Sequence:CCGGCGGTGGATACACTCTCAGTTACTCGAGTAACTGAGAGTGTATCCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002499.1-4860s1c1
Sequence:CCGGGCATCACCTTTATGGAGTGTACTCGAGTACACTCCATAAAGGTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002499.1-1403s1c1
Sequence:CCGGGCCCAACTGATAATCCTTGAACTCGAGTTCAAGGATTATCAGTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)