EMAIL THIS PAGE TO A FRIEND

NES

nestin

74 Gene Product Result for
UniProtKB ID: P48681, O00552, Q3LIF5, Q5SYZ6
Gene ID:
Human(10763) Summary: This gene encodes a member of the intermediate filament protein family and is expressed primarily in nerve cells. [provided by RefSeq, Sep 2011]
Mouse(18008) nestin
Rat(25491) nestin
dog(490410) nestin
cow(522383) nestin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA007007 Anti-NES antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA026111 Anti-NES antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2104575 Anti-NES antibody produced in rabbit affinity isolated antibody human, horse, canine
western blot pricing
HPA006286 Anti-NES antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB4200347 Anti-Nestin (C-terminal region) antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody mouse, human, rat
immunofluorescence, western blot pricing
SAB4200394 Anti-Nestin (C-terminal) antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody rat, mouse
immunofluorescence, western blot pricing
SAB1305645 ANTI-NESTIN (S1409) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, flow cytometry, immunohistochemistry, western blot pricing
N5413 Anti-Nestin antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, rat, human
flow cytometry, immunohistochemistry, western blot pricing
SAB5500150 Anti-Nestin antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP103, affinity isolated antibody human (tested)
immunohistochemistry, western blot pricing
AMAB90556 Monoclonal Anti-NES antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0197, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1592 Human Nestin ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006617 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006617 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006617 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016701 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016701 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016701 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
MAB5326 Anti-Nestin Antibody, clone 10C2 This Anti-Nestin Antibody, clone 10C2 is validated for use in IC, IH, IH(P), WB for the detection of Nestin. pricing
MAB5326A4 Anti-Nestin Antibody, clone 10C2, Alexa Fluor® 488 conjugate Anti-Nestin Antibody, clone 10C2, Alexa Fluor 488 conjugate detects level of Nestin & has been published & validated for use in ICC. pricing
MAB5326B Anti-Nestin Antibody, clone 10C2, Biotin Conjugate Detect Nestin using this mouse monoclonal antibody, Anti-Nestin Antibody, clone 10C2, Biotin Conjugate validated for use in ICC & IHC. pricing
MAB5326C3 Anti-Nestin Antibody, clone 10C2, Cy3 conjugate Detect Nestin using this Anti-Nestin Antibody, clone 10C2, Cy3 conjugate validated for use in ICC. pricing
MAB353 Anti-Nestin Antibody, clone rat-401 Detect Nestin using this Anti-Nestin Antibody, clone rat-401 validated for use in IC, IH, IH(P) & WB. pricing
MAB353A4 Anti-Nestin Antibody, clone rat-401, Alexa Fluor® 488 conjugate Detect the Nestin protein using this Anti-Nestin, clone rat-401, Alexa Fluor 488 conjugate validated for use in ICC. pricing
MAB353B Anti-Nestin Antibody, clone rat-401, Biotin Conjugate Detect Nestin using this mouse monoclonal antibody, Anti-Nestin Antibody, clone rat-401, Biotin Conjugate validated for use in ICC & IHC. pricing
MAB353C3 Anti-Nestin Antibody, clone rat-401, Cy3 conjugate This Anti-Nestin Antibody, clone rat-401, Cy3 conjugate is validated for use in ICC for the detection of Nestin. pricing
IHCR1006-6 Anti-Nestin Antibody, prediluted, clone rat-401 Anti-Nestin Antibody, prediluted, clone rat-401 detects level of Nestin & has been published & validated for use in IH(P). pricing
FCMAB313PE Milli-Mark® Anti-Nestin-PE Antibody, clone 10C2 Detect Nestin using this Milli-Mark Anti-Nestin-PE Antibody, clone 10C2 validated for use in FC. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006617 Rosetta Predictions human pricing
NM_012987 Rosetta Predictions rat pricing
NM_016701 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006617 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341959 predicted 1962
2 SASI_Hs01_00097739 predicted 1552
3 SASI_Hs01_00097740 predicted 2705
4 SASI_Hs01_00097741 predicted 2511
5 SASI_Hs01_00097742 predicted 5083
6 SASI_Hs02_00341960 predicted 4944
7 SASI_Hs01_00097744 predicted 4661
8 SASI_Hs01_00097745 predicted 2600
9 SASI_Hs01_00097746 predicted 4818
10 SASI_Hs01_00097747 predicted 2783
11 SASI_Hs01_00097738 predicted 2395
12 SASI_Hs01_00097743 predicted 2028
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012987 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260619 predicted 2474
2 SASI_Rn01_00118544 predicted 1554
3 SASI_Rn02_00260620 predicted 1853
4 SASI_Rn01_00118545 predicted 1982
5 SASI_Rn01_00118546 predicted 2916
6 SASI_Rn01_00118548 predicted 5396
7 SASI_Rn01_00118549 predicted 1862
8 SASI_Rn02_00260621 predicted 2557
9 SASI_Rn01_00118550 predicted 3488
10 SASI_Rn01_00118551 predicted 3898
11 SASI_Rn01_00118547 predicted 3340
12 SASI_Rn01_00118552 predicted 5638
13 SASI_Rn01_00118553 predicted 1012
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016701 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160027 predicted 1545
2 SASI_Mm02_00323367 predicted 3627
3 SASI_Mm01_00160028 predicted 2051
4 SASI_Mm01_00160029 predicted 3477
5 SASI_Mm02_00323368 predicted 2684
6 SASI_Mm02_00323369 predicted 1464
7 SASI_Mm02_00323370 predicted 3375
8 SASI_Mm01_00160031 predicted 2799
9 SASI_Mm01_00160032 predicted 3349
10 SASI_Mm01_00160033 predicted 1278
11 SASI_Mm01_00160025 predicted 3619
12 SASI_Mm01_00160026 predicted 1592
13 SASI_Mm01_00160030 predicted 999
14 SASI_Mm01_00160034 predicted 1855
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006617
NES MISSION shRNA Bacterial Glycerol Stock
nestin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006617.1-1957s21c1
Sequence:CCGGAGAGGCTGTAGGCCAACTTAACTCGAGTTAAGTTGGCCTACAGCCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006617.1-5179s21c1
Sequence:CCGGGAATGGAGGCTGTAGGAATATCTCGAGATATTCCTACAGCCTCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006617.1-2444s21c1
Sequence:CCGGGAACAGGATCAGATGACATTACTCGAGTAATGTCATCTGATCCTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006617.1-1850s21c1
Sequence:CCGGCAAGAATGTCCGAGGTCTTTACTCGAGTAAAGACCTCGGACATTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006617.1-5081s1c1
Sequence:CCGGGCAGCACTCTTAACTTACGATCTCGAGATCGTAAGTTAAGAGTGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006617.1-2546s1c1
Sequence:CCGGGAGTTCTTAAAGTCACTCAAACTCGAGTTTGAGTGACTTTAAGAACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006617.1-1241s1c1
Sequence:CCGGGCCTTTCTTAAGAACCAAGAACTCGAGTTCTTGGTTCTTAAGAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006617.1-1552s1c1
Sequence:CCGGCCACTCCAGTTTAGAGGCTAACTCGAGTTAGCCTCTAAACTGGAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006617.1-4721s1c1
Sequence:CCGGGCAGACATCATTGGTGTTAATCTCGAGATTAACACCAATGATGTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006617
NES MISSION shRNA shRNA Plasmid DNA
nestin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006617.1-1957s21c1
Sequence:CCGGAGAGGCTGTAGGCCAACTTAACTCGAGTTAAGTTGGCCTACAGCCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006617.1-5179s21c1
Sequence:CCGGGAATGGAGGCTGTAGGAATATCTCGAGATATTCCTACAGCCTCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006617.1-2444s21c1
Sequence:CCGGGAACAGGATCAGATGACATTACTCGAGTAATGTCATCTGATCCTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006617.1-1850s21c1
Sequence:CCGGCAAGAATGTCCGAGGTCTTTACTCGAGTAAAGACCTCGGACATTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006617.1-5081s1c1
Sequence:CCGGGCAGCACTCTTAACTTACGATCTCGAGATCGTAAGTTAAGAGTGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006617.1-2546s1c1
Sequence:CCGGGAGTTCTTAAAGTCACTCAAACTCGAGTTTGAGTGACTTTAAGAACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006617.1-1241s1c1
Sequence:CCGGGCCTTTCTTAAGAACCAAGAACTCGAGTTCTTGGTTCTTAAGAAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006617.1-1552s1c1
Sequence:CCGGCCACTCCAGTTTAGAGGCTAACTCGAGTTAGCCTCTAAACTGGAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006617.1-4721s1c1
Sequence:CCGGGCAGACATCATTGGTGTTAATCTCGAGATTAACACCAATGATGTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006617
NES MISSION shRNA Lentiviral Transduction Particles
nestin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006617.1-1957s21c1
Sequence:CCGGAGAGGCTGTAGGCCAACTTAACTCGAGTTAAGTTGGCCTACAGCCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006617.1-5179s21c1
Sequence:CCGGGAATGGAGGCTGTAGGAATATCTCGAGATATTCCTACAGCCTCCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006617.1-2444s21c1
Sequence:CCGGGAACAGGATCAGATGACATTACTCGAGTAATGTCATCTGATCCTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006617.1-1850s21c1
Sequence:CCGGCAAGAATGTCCGAGGTCTTTACTCGAGTAAAGACCTCGGACATTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006617.1-5081s1c1
Sequence:CCGGGCAGCACTCTTAACTTACGATCTCGAGATCGTAAGTTAAGAGTGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006617.1-2546s1c1
Sequence:CCGGGAGTTCTTAAAGTCACTCAAACTCGAGTTTGAGTGACTTTAAGAACTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006617.1-1241s1c1
Sequence:CCGGGCCTTTCTTAAGAACCAAGAACTCGAGTTCTTGGTTCTTAAGAAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006617.1-1552s1c1
Sequence:CCGGCCACTCCAGTTTAGAGGCTAACTCGAGTTAGCCTCTAAACTGGAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006617.1-4721s1c1
Sequence:CCGGGCAGACATCATTGGTGTTAATCTCGAGATTAACACCAATGATGTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016701
VALIDATED
NES MISSION shRNA Bacterial Glycerol Stock
nestin
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016701.3-1293s21c1
Sequence:CCGGTCTGAGGCTCCCTATCCTAAACTCGAGTTTAGGATAGGGAGCCTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016701.3-1500s21c1
Sequence:CCGGCTCAACCCTCACCACTCTATTCTCGAGAATAGAGTGGTGAGGGTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215702    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016701.3-5776s1c1
Sequence:CCGGCTCTTAGCTTTGATAACTTGACTCGAGTCAAGTTATCAAAGCTAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016701.3-2180s21c1
Sequence:CCGGAGAAGACCAGCAGGCGTTTAGCTCGAGCTAAACGCCTGCTGGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016701.3-5869s21c1
Sequence:CCGGTCAGGTCAGCTGAGCCTATAGCTCGAGCTATAGGCTCAGCTGACCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016701.2-3694s1c1
Sequence:CCGGCAGGAGTGGAAACTGAGGATACTCGAGTATCCTCAGTTTCCACTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016701.2-5226s1c1
Sequence:CCGGCAAGCGATTGACCATTTAGATCTCGAGATCTAAATGGTCAATCGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016701.2-2289s1c1
Sequence:CCGGGCATTTAGACTTCTGGAGAAACTCGAGTTTCTCCAGAAGTCTAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016701
VALIDATED
NES MISSION shRNA shRNA Plasmid DNA
nestin
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016701.3-1293s21c1
Sequence:CCGGTCTGAGGCTCCCTATCCTAAACTCGAGTTTAGGATAGGGAGCCTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016701.3-1500s21c1
Sequence:CCGGCTCAACCCTCACCACTCTATTCTCGAGAATAGAGTGGTGAGGGTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215702    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016701.3-5776s1c1
Sequence:CCGGCTCTTAGCTTTGATAACTTGACTCGAGTCAAGTTATCAAAGCTAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016701.3-2180s21c1
Sequence:CCGGAGAAGACCAGCAGGCGTTTAGCTCGAGCTAAACGCCTGCTGGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016701.3-5869s21c1
Sequence:CCGGTCAGGTCAGCTGAGCCTATAGCTCGAGCTATAGGCTCAGCTGACCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016701.2-3694s1c1
Sequence:CCGGCAGGAGTGGAAACTGAGGATACTCGAGTATCCTCAGTTTCCACTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016701.2-5226s1c1
Sequence:CCGGCAAGCGATTGACCATTTAGATCTCGAGATCTAAATGGTCAATCGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016701.2-2289s1c1
Sequence:CCGGGCATTTAGACTTCTGGAGAAACTCGAGTTTCTCCAGAAGTCTAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016701
VALIDATED
NES MISSION shRNA Lentiviral Transduction Particles
nestin
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016701.3-1293s21c1
Sequence:CCGGTCTGAGGCTCCCTATCCTAAACTCGAGTTTAGGATAGGGAGCCTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016701.3-1500s21c1
Sequence:CCGGCTCAACCCTCACCACTCTATTCTCGAGAATAGAGTGGTGAGGGTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215702    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016701.3-5776s1c1
Sequence:CCGGCTCTTAGCTTTGATAACTTGACTCGAGTCAAGTTATCAAAGCTAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016701.3-2180s21c1
Sequence:CCGGAGAAGACCAGCAGGCGTTTAGCTCGAGCTAAACGCCTGCTGGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016701.3-5869s21c1
Sequence:CCGGTCAGGTCAGCTGAGCCTATAGCTCGAGCTATAGGCTCAGCTGACCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016701.2-3694s1c1
Sequence:CCGGCAGGAGTGGAAACTGAGGATACTCGAGTATCCTCAGTTTCCACTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016701.2-5226s1c1
Sequence:CCGGCAAGCGATTGACCATTTAGATCTCGAGATCTAAATGGTCAATCGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016701.2-2289s1c1
Sequence:CCGGGCATTTAGACTTCTGGAGAAACTCGAGTTTCTCCAGAAGTCTAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)