EMAIL THIS PAGE TO A FRIEND

NET1

neuroepithelial cell transforming 1

83 Gene Product Result for
Synonyms: ARHGEF8 NET1A
UniProtKB ID: Q7Z628, Q12773, Q96D82, Q99903, Q9UEN6
Gene ID:
Human(10276) Summary: This gene is part of the family of Rho guanine nucleotide exchange factors. Members of this family activate Rho proteins by catalyzing the exchange of GDP for GTP. The protein encoded by this gene interacts with RhoA within the cell nucleus and may play a role in repairing DNA damage after ionizing radiation. Pseudogenes of this gene are located on the long arms of chromosomes 1, 7 and 18. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
Mouse(56349) neuroepithelial cell transforming gene 1
Rat(307098) neuroepithelial cell transforming 1
Zebrafish(493607) neuroepithelial cell transforming gene 1
chicken(416693) neuroepithelial cell transforming 1
dog(487147) neuroepithelial cell transforming 1
Horse(100070450) neuroepithelial cell transforming 1
cow(507365) neuroepithelial cell transforming 1
domestic cat(101098799) neuroepithelial cell transforming 1
sheep(101106096) neuroepithelial cell transforming 1
Domestic Rabbit(100350121) neuroepithelial cell transforming 1
naked mole-rat(101716290) neuroepithelial cell transforming 1
domestic guinea pig(100728896) neuroepithelial cell transforming 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005863 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005863 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005863 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019671 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019671 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019671 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001047160 Rosetta Predictions human pricing
NM_005863 siRNAs that have been validated in the lab human pricing
NM_001039023 Rosetta Predictions rat pricing
NM_001047159 Rosetta Predictions mouse pricing
NM_019671 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311487 predicted 1184
2 SASI_Hs02_00311488 predicted 1273
3 SASI_Hs02_00311489 predicted 1497
4 SASI_Hs02_00311490 predicted 893
5 SASI_Hs02_00311491 predicted 1208
6 SASI_Hs02_00311492 predicted 1402
7 SASI_Hs02_00311493 predicted 1754
8 SASI_Hs02_00311494 predicted 1130
9 SASI_Hs02_00311495 predicted 694
10 SASI_Hs02_00311496 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005863 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099864 validated 1156
2 SASI_Hs01_00099862 predicted 1066
3 SASI_Hs01_00099865 predicted 1384
4 SASI_Hs01_00099866 predicted 782
5 SASI_Hs01_00099869 predicted 1091
6 SASI_Hs01_00099870 predicted 1286
7 SASI_Hs01_00099871 predicted 1632
8 SASI_Hs02_00340425 predicted 1019
9 SASI_Hs02_00340426 predicted 580
10 SASI_Hs02_00340427 predicted 501
11 SASI_Hs01_00099863 predicted 333
12 SASI_Hs01_00099867 predicted 730
13 SASI_Hs01_00099868 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039023 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111650 predicted 995
2 SASI_Rn01_00111651 predicted 825
3 SASI_Rn01_00111652 predicted 276
4 SASI_Rn01_00111654 predicted 434
5 SASI_Rn01_00111655 predicted 220
6 SASI_Rn01_00111656 predicted 270
7 SASI_Rn01_00111657 predicted 960
8 SASI_Rn01_00111658 predicted 548
9 SASI_Rn02_00204760 predicted 1546
10 SASI_Rn02_00204761 predicted 1289
11 SASI_Rn01_00111653 predicted 212
12 SASI_Rn01_00111659 predicted 911
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047159 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291891 predicted 1032
2 SASI_Mm02_00291892 predicted 1100
3 SASI_Mm02_00291893 predicted 1027
4 SASI_Mm02_00291894 predicted 937
5 SASI_Mm02_00291895 predicted 1685
6 SASI_Mm02_00291896 predicted 1019
7 SASI_Mm02_00291897 predicted 1044
8 SASI_Mm02_00291898 predicted 690
9 SASI_Mm02_00291899 predicted 794
10 SASI_Mm02_00291900 predicted 1650
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019671 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058619 predicted 1156
2 SASI_Mm02_00324733 predicted 1224
3 SASI_Mm02_00324734 predicted 1153
4 SASI_Mm02_00324735 predicted 1059
5 SASI_Mm01_00058624 predicted 1808
6 SASI_Mm02_00324736 predicted 1139
7 SASI_Mm02_00324737 predicted 1176
8 SASI_Mm02_00324738 predicted 810
9 SASI_Mm02_00324739 predicted 914
10 SASI_Mm02_00324740 predicted 1778
11 SASI_Mm01_00058615 predicted 1818
12 SASI_Mm01_00058616 predicted 1933
13 SASI_Mm01_00058617 predicted 1889
14 SASI_Mm01_00058618 predicted 1914
15 SASI_Mm01_00058620 predicted 1108
16 SASI_Mm01_00058621 predicted 364
17 SASI_Mm01_00058622 predicted 338
18 SASI_Mm01_00058623 predicted 411
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005863
VALIDATED
NET1 MISSION shRNA Bacterial Glycerol Stock
neuroepithelial cell transforming 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005863.2-924s1c1
Sequence:CCGGCGCCTAGTCAAATACCCTTTACTCGAGTAAAGGGTATTTGACTAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005863.2-532s1c1
Sequence:CCGGCCCGAGGTGAACAGGATTTAACTCGAGTTAAATCCTGTTCACCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005863.2-1172s1c1
Sequence:CCGGGAGTGGACATAAACTTTACATCTCGAGATGTAAAGTTTATGTCCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005863.2-1347s1c1
Sequence:CCGGGCTTTCAGTAACTCAGAGAAACTCGAGTTTCTCTGAGTTACTGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005863.3-1888s21c1
Sequence:CCGGGAGCATCATAGGGTTACTTTACTCGAGTAAAGTAACCCTATGATGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005863.2-802s1c1
Sequence:CCGGCCAAAGCTCTTCTTGATCAAACTCGAGTTTGATCAAGAAGAGCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005863.3-313s21c1
Sequence:CCGGGTCACGTCCTTGGCAAATTTACTCGAGTAAATTTGCCAAGGACGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005863.3-1039s21c1
Sequence:CCGGGAGGATGCTATATTGATAATACTCGAGTATTATCAATATAGCATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005863.3-1095s21c1
Sequence:CCGGTGAATCCGAGTGCCAGTATTACTCGAGTAATACTGGCACTCGGATTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005863
VALIDATED
NET1 MISSION shRNA shRNA Plasmid DNA
neuroepithelial cell transforming 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005863.2-924s1c1
Sequence:CCGGCGCCTAGTCAAATACCCTTTACTCGAGTAAAGGGTATTTGACTAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005863.2-532s1c1
Sequence:CCGGCCCGAGGTGAACAGGATTTAACTCGAGTTAAATCCTGTTCACCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005863.2-1172s1c1
Sequence:CCGGGAGTGGACATAAACTTTACATCTCGAGATGTAAAGTTTATGTCCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005863.2-1347s1c1
Sequence:CCGGGCTTTCAGTAACTCAGAGAAACTCGAGTTTCTCTGAGTTACTGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005863.3-1888s21c1
Sequence:CCGGGAGCATCATAGGGTTACTTTACTCGAGTAAAGTAACCCTATGATGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005863.2-802s1c1
Sequence:CCGGCCAAAGCTCTTCTTGATCAAACTCGAGTTTGATCAAGAAGAGCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005863.3-313s21c1
Sequence:CCGGGTCACGTCCTTGGCAAATTTACTCGAGTAAATTTGCCAAGGACGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005863.3-1039s21c1
Sequence:CCGGGAGGATGCTATATTGATAATACTCGAGTATTATCAATATAGCATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005863.3-1095s21c1
Sequence:CCGGTGAATCCGAGTGCCAGTATTACTCGAGTAATACTGGCACTCGGATTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005863
VALIDATED
NET1 MISSION shRNA Lentiviral Transduction Particles
neuroepithelial cell transforming 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005863.2-924s1c1
Sequence:CCGGCGCCTAGTCAAATACCCTTTACTCGAGTAAAGGGTATTTGACTAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005863.2-532s1c1
Sequence:CCGGCCCGAGGTGAACAGGATTTAACTCGAGTTAAATCCTGTTCACCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005863.2-1172s1c1
Sequence:CCGGGAGTGGACATAAACTTTACATCTCGAGATGTAAAGTTTATGTCCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005863.2-1347s1c1
Sequence:CCGGGCTTTCAGTAACTCAGAGAAACTCGAGTTTCTCTGAGTTACTGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005863.3-1888s21c1
Sequence:CCGGGAGCATCATAGGGTTACTTTACTCGAGTAAAGTAACCCTATGATGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005863.2-802s1c1
Sequence:CCGGCCAAAGCTCTTCTTGATCAAACTCGAGTTTGATCAAGAAGAGCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005863.3-313s21c1
Sequence:CCGGGTCACGTCCTTGGCAAATTTACTCGAGTAAATTTGCCAAGGACGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005863.3-1039s21c1
Sequence:CCGGGAGGATGCTATATTGATAATACTCGAGTATTATCAATATAGCATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005863.3-1095s21c1
Sequence:CCGGTGAATCCGAGTGCCAGTATTACTCGAGTAATACTGGCACTCGGATTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019671
VALIDATED
NET1 MISSION shRNA Bacterial Glycerol Stock
neuroepithelial cell transforming 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019671.2-368s21c1
Sequence:CCGGGAAAGATGATGATGCTGTAAGCTCGAGCTTACAGCATCATCATCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019671.2-296s21c1
Sequence:CCGGGAGAGGCAGCTCCTTCACATTCTCGAGAATGTGAAGGAGCTGCCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019671.1-1125s1c1
Sequence:CCGGCGAATCTGAGTGTCAGTATTACTCGAGTAATACTGACACTCAGATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019671.1-2318s1c1
Sequence:CCGGCGCATGGAACAGATTTGAGATCTCGAGATCTCAAATCTGTTCCATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019671.2-811s21c1
Sequence:CCGGTTGGAGACTTGGATGCTTATACTCGAGTATAAGCATCCAAGTCTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019671.1-1241s1c1
Sequence:CCGGGCGGCCATAAACTGTACATTTCTCGAGAAATGTACAGTTTATGGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019671.1-1419s1c1
Sequence:CCGGCGGCAACTCAGACAAAGCTAACTCGAGTTAGCTTTGTCTGAGTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019671.1-356s1c1
Sequence:CCGGCAAACTTAATCTCTCCCGTAACTCGAGTTACGGGAGAGATTAAGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019671.2-2422s21c1
Sequence:CCGGCGCATGGAACAGATTTGAGATCTCGAGATCTCAAATCTGTTCCATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019671.2-1229s21c1
Sequence:CCGGCGAATCTGAGTGTCAGTATTACTCGAGTAATACTGACACTCAGATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019671.2-404s21c1
Sequence:CCGGTTTGAAGGAGCCAAGCAATAACTCGAGTTATTGCTTGGCTCCTTCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019671.2-214s21c1
Sequence:CCGGTCTCAATGCTCAGCGAGGAACCTCGAGGTTCCTCGCTGAGCATTGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019671
VALIDATED
NET1 MISSION shRNA shRNA Plasmid DNA
neuroepithelial cell transforming 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019671.2-368s21c1
Sequence:CCGGGAAAGATGATGATGCTGTAAGCTCGAGCTTACAGCATCATCATCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019671.2-296s21c1
Sequence:CCGGGAGAGGCAGCTCCTTCACATTCTCGAGAATGTGAAGGAGCTGCCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019671.1-1125s1c1
Sequence:CCGGCGAATCTGAGTGTCAGTATTACTCGAGTAATACTGACACTCAGATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019671.1-2318s1c1
Sequence:CCGGCGCATGGAACAGATTTGAGATCTCGAGATCTCAAATCTGTTCCATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019671.2-811s21c1
Sequence:CCGGTTGGAGACTTGGATGCTTATACTCGAGTATAAGCATCCAAGTCTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019671.1-1241s1c1
Sequence:CCGGGCGGCCATAAACTGTACATTTCTCGAGAAATGTACAGTTTATGGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019671.1-1419s1c1
Sequence:CCGGCGGCAACTCAGACAAAGCTAACTCGAGTTAGCTTTGTCTGAGTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019671.1-356s1c1
Sequence:CCGGCAAACTTAATCTCTCCCGTAACTCGAGTTACGGGAGAGATTAAGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019671.2-2422s21c1
Sequence:CCGGCGCATGGAACAGATTTGAGATCTCGAGATCTCAAATCTGTTCCATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019671.2-1229s21c1
Sequence:CCGGCGAATCTGAGTGTCAGTATTACTCGAGTAATACTGACACTCAGATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019671.2-404s21c1
Sequence:CCGGTTTGAAGGAGCCAAGCAATAACTCGAGTTATTGCTTGGCTCCTTCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019671.2-214s21c1
Sequence:CCGGTCTCAATGCTCAGCGAGGAACCTCGAGGTTCCTCGCTGAGCATTGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019671
VALIDATED
NET1 MISSION shRNA Lentiviral Transduction Particles
neuroepithelial cell transforming 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019671.2-368s21c1
Sequence:CCGGGAAAGATGATGATGCTGTAAGCTCGAGCTTACAGCATCATCATCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019671.2-296s21c1
Sequence:CCGGGAGAGGCAGCTCCTTCACATTCTCGAGAATGTGAAGGAGCTGCCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019671.1-1125s1c1
Sequence:CCGGCGAATCTGAGTGTCAGTATTACTCGAGTAATACTGACACTCAGATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019671.1-2318s1c1
Sequence:CCGGCGCATGGAACAGATTTGAGATCTCGAGATCTCAAATCTGTTCCATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019671.2-811s21c1
Sequence:CCGGTTGGAGACTTGGATGCTTATACTCGAGTATAAGCATCCAAGTCTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019671.1-1241s1c1
Sequence:CCGGGCGGCCATAAACTGTACATTTCTCGAGAAATGTACAGTTTATGGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019671.1-1419s1c1
Sequence:CCGGCGGCAACTCAGACAAAGCTAACTCGAGTTAGCTTTGTCTGAGTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019671.1-356s1c1
Sequence:CCGGCAAACTTAATCTCTCCCGTAACTCGAGTTACGGGAGAGATTAAGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019671.2-2422s21c1
Sequence:CCGGCGCATGGAACAGATTTGAGATCTCGAGATCTCAAATCTGTTCCATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019671.2-1229s21c1
Sequence:CCGGCGAATCTGAGTGTCAGTATTACTCGAGTAATACTGACACTCAGATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019671.2-404s21c1
Sequence:CCGGTTTGAAGGAGCCAAGCAATAACTCGAGTTATTGCTTGGCTCCTTCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019671.2-214s21c1
Sequence:CCGGTCTCAATGCTCAGCGAGGAACCTCGAGGTTCCTCGCTGAGCATTGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)