EMAIL THIS PAGE TO A FRIEND

NETO1

neuropilin (NRP) and tolloid (TLL)-like 1

73 Gene Product Result for
Synonyms: BCTL1 BTCL1
UniProtKB ID: Q8TDF5, Q86W85, Q8ND78, Q8TDF4
Gene ID:
Human(81832) Summary: This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in mice encodes a protein that plays a critical role in spatial learning and memory by regulating the function of synaptic N-methyl-D-aspartic acid receptor complexes in the hippocampus. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
Mouse(246317) neuropilin (NRP) and tolloid (TLL)-like 1
Rat(307206) neuropilin (NRP) and tolloid (TLL)-like 1
Zebrafish(556922) neuropilin (NRP) and tolloid (TLL)-like 1
chicken(421018) neuropilin (NRP) and tolloid (TLL)-like 1
dog(483935) neuropilin (NRP) and tolloid (TLL)-like 1
domestic cat(101095288) neuropilin (NRP) and tolloid (TLL)-like 1
cow(530407) neuropilin (NRP) and tolloid (TLL)-like 1
Horse(100061141) neuropilin (NRP) and tolloid (TLL)-like 1
domestic guinea pig(100731272) neuropilin (NRP) and tolloid (TLL)-like 1
naked mole-rat(101713300) neuropilin (NRP) and tolloid (TLL)-like 1
Domestic Rabbit(100347490) neuropilin (NRP) and tolloid (TLL)-like 1
sheep(101102607) neuropilin (NRP) and tolloid (TLL)-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138966 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138966 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138966 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144946 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144946 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144946 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU139961 MISSION® esiRNA esiRNA human NETO1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138966 Rosetta Predictions human pricing
NM_138999 Rosetta Predictions human pricing
NM_153181 Rosetta Predictions human pricing
NM_001107371 Rosetta Predictions rat pricing
NM_144946 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138966 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204588 predicted 1235
2 SASI_Hs01_00204589 predicted 914
3 SASI_Hs01_00204590 predicted 514
4 SASI_Hs02_00364017 predicted 1333
5 SASI_Hs01_00204592 predicted 1012
6 SASI_Hs01_00204593 predicted 1407
7 SASI_Hs01_00204594 predicted 821
8 SASI_Hs01_00204595 predicted 939
9 SASI_Hs01_00204596 predicted 1751
10 SASI_Hs01_00204597 predicted 776
11 SASI_Hs01_00204591 predicted 1183
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138999 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070672 predicted 282
2 SASI_Hs01_00070673 predicted 284
3 SASI_Hs01_00070674 predicted 334
4 SASI_Hs01_00070675 predicted 322
5 SASI_Hs01_00070676 predicted 257
6 SASI_Hs01_00070677 predicted 321
7 SASI_Hs01_00070678 predicted 303
8 SASI_Hs02_00364043 predicted 333
9 SASI_Hs01_00070679 predicted 240
10 SASI_Hs01_00070680 predicted 212
11 SASI_Hs01_00070681 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205904 predicted 1041
2 SASI_Hs01_00205905 predicted 733
3 SASI_Hs01_00205906 predicted 334
4 SASI_Hs02_00367009 predicted 1155
5 SASI_Hs01_00205908 predicted 822
6 SASI_Hs01_00205909 predicted 1220
7 SASI_Hs01_00205910 predicted 632
8 SASI_Hs01_00205911 predicted 755
9 SASI_Hs01_00205912 predicted 1562
10 SASI_Hs01_00205913 predicted 600
11 SASI_Hs01_00205907 predicted 1004
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107371 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228165 predicted 1623
2 SASI_Rn02_00228166 predicted 1872
3 SASI_Rn02_00228167 predicted 1972
4 SASI_Rn02_00228168 predicted 1096
5 SASI_Rn02_00228169 predicted 2345
6 SASI_Rn02_00228170 predicted 1290
7 SASI_Rn02_00228171 predicted 2083
8 SASI_Rn02_00228172 predicted 2183
9 SASI_Rn02_00228173 predicted 1825
10 SASI_Rn02_00228174 predicted 2014
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144946 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150484 predicted 1877
2 SASI_Mm01_00150485 predicted 1969
3 SASI_Mm01_00150486 predicted 1501
4 SASI_Mm01_00150487 predicted 1288
5 SASI_Mm02_00340469 predicted 1202
6 SASI_Mm01_00150489 predicted 2020
7 SASI_Mm01_00150490 predicted 2342
8 SASI_Mm02_00340470 predicted 949
9 SASI_Mm01_00150491 predicted 1264
10 SASI_Mm01_00150492 predicted 957
11 SASI_Mm01_00150488 predicted 1880
12 SASI_Mm01_00150493 predicted 1388
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138966
NETO1 MISSION shRNA Bacterial Glycerol Stock
neuropilin (NRP) and tolloid (TLL)-like 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138966.2-424s21c1
Sequence:CCGGATGCAGAGGGAGGTATCTTTACTCGAGTAAAGATACCTCCCTCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138966.2-2058s21c1
Sequence:CCGGCTGATATGTTCATTTCGTAATCTCGAGATTACGAAATGAACATATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138966.2-735s1c1
Sequence:CCGGCGATACAATTTCACACCTGATCTCGAGATCAGGTGTGAAATTGTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138966.2-820s1c1
Sequence:CCGGCCGAAGGAATTGTGGAGTCTACTCGAGTAGACTCCACAATTCCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138966.2-1349s1c1
Sequence:CCGGCCTCATTATCATCTCTGTCATCTCGAGATGACAGAGATGATAATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138966.2-348s1c1
Sequence:CCGGGCAACCAAGAAAGGAACAGAACTCGAGTTCTGTTCCTTTCTTGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138966.2-1828s1c1
Sequence:CCGGTCTGCCTCATTGGGTCTCTAACTCGAGTTAGAGACCCAATGAGGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138966.2-558s21c1
Sequence:CCGGCCGTCTTGGGAGTGCAAATTTCTCGAGAAATTTGCACTCCCAAGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138966
NETO1 MISSION shRNA shRNA Plasmid DNA
neuropilin (NRP) and tolloid (TLL)-like 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138966.2-424s21c1
Sequence:CCGGATGCAGAGGGAGGTATCTTTACTCGAGTAAAGATACCTCCCTCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138966.2-2058s21c1
Sequence:CCGGCTGATATGTTCATTTCGTAATCTCGAGATTACGAAATGAACATATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138966.2-735s1c1
Sequence:CCGGCGATACAATTTCACACCTGATCTCGAGATCAGGTGTGAAATTGTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138966.2-820s1c1
Sequence:CCGGCCGAAGGAATTGTGGAGTCTACTCGAGTAGACTCCACAATTCCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138966.2-1349s1c1
Sequence:CCGGCCTCATTATCATCTCTGTCATCTCGAGATGACAGAGATGATAATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138966.2-348s1c1
Sequence:CCGGGCAACCAAGAAAGGAACAGAACTCGAGTTCTGTTCCTTTCTTGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138966.2-1828s1c1
Sequence:CCGGTCTGCCTCATTGGGTCTCTAACTCGAGTTAGAGACCCAATGAGGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138966.2-558s21c1
Sequence:CCGGCCGTCTTGGGAGTGCAAATTTCTCGAGAAATTTGCACTCCCAAGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138966
NETO1 MISSION shRNA Lentiviral Transduction Particles
neuropilin (NRP) and tolloid (TLL)-like 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138966.2-424s21c1
Sequence:CCGGATGCAGAGGGAGGTATCTTTACTCGAGTAAAGATACCTCCCTCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138966.2-2058s21c1
Sequence:CCGGCTGATATGTTCATTTCGTAATCTCGAGATTACGAAATGAACATATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138966.2-735s1c1
Sequence:CCGGCGATACAATTTCACACCTGATCTCGAGATCAGGTGTGAAATTGTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138966.2-820s1c1
Sequence:CCGGCCGAAGGAATTGTGGAGTCTACTCGAGTAGACTCCACAATTCCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138966.2-1349s1c1
Sequence:CCGGCCTCATTATCATCTCTGTCATCTCGAGATGACAGAGATGATAATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138966.2-348s1c1
Sequence:CCGGGCAACCAAGAAAGGAACAGAACTCGAGTTCTGTTCCTTTCTTGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138966.2-1828s1c1
Sequence:CCGGTCTGCCTCATTGGGTCTCTAACTCGAGTTAGAGACCCAATGAGGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138966.2-558s21c1
Sequence:CCGGCCGTCTTGGGAGTGCAAATTTCTCGAGAAATTTGCACTCCCAAGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144946
NETO1 MISSION shRNA Bacterial Glycerol Stock
neuropilin (NRP) and tolloid (TLL)-like 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000087560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144946.2-966s1c1
Sequence:CCGGGCAAGTTTAATCATCCTCCATCTCGAGATGGAGGATGATTAAACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144946.2-1128s1c1
Sequence:CCGGCGAGAGTGTGTCTACATCATACTCGAGTATGATGTAGACACACTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144946.2-1556s1c1
Sequence:CCGGCCCACCACGATCCAAGATTTACTCGAGTAAATCTTGGATCGTGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144946.2-1094s1c1
Sequence:CCGGGTCTCCCAATTATCCCAGCAACTCGAGTTGCTGGGATAATTGGGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144946
NETO1 MISSION shRNA shRNA Plasmid DNA
neuropilin (NRP) and tolloid (TLL)-like 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000087560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144946.2-966s1c1
Sequence:CCGGGCAAGTTTAATCATCCTCCATCTCGAGATGGAGGATGATTAAACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144946.2-1128s1c1
Sequence:CCGGCGAGAGTGTGTCTACATCATACTCGAGTATGATGTAGACACACTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144946.2-1556s1c1
Sequence:CCGGCCCACCACGATCCAAGATTTACTCGAGTAAATCTTGGATCGTGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144946.2-1094s1c1
Sequence:CCGGGTCTCCCAATTATCCCAGCAACTCGAGTTGCTGGGATAATTGGGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144946
NETO1 MISSION shRNA Lentiviral Transduction Particles
neuropilin (NRP) and tolloid (TLL)-like 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000087560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144946.2-966s1c1
Sequence:CCGGGCAAGTTTAATCATCCTCCATCTCGAGATGGAGGATGATTAAACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144946.2-1128s1c1
Sequence:CCGGCGAGAGTGTGTCTACATCATACTCGAGTATGATGTAGACACACTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144946.2-1556s1c1
Sequence:CCGGCCCACCACGATCCAAGATTTACTCGAGTAAATCTTGGATCGTGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144946.2-1094s1c1
Sequence:CCGGGTCTCCCAATTATCCCAGCAACTCGAGTTGCTGGGATAATTGGGAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)