EMAIL THIS PAGE TO A FRIEND

NETO2

neuropilin (NRP) and tolloid (TLL)-like 2

193 Gene Product Result for
Synonyms: BTCL2 NEOT2
UniProtKB ID: Q8NC67, Q7Z381, Q8ND51, Q96SP4, Q9NVY8
Gene ID:
Human(81831) Summary: This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in rats encodes a protein that modulates glutamate signaling in the brain by regulating kainate receptor function. Expression of this gene may be a biomarker for proliferating infantile hemangiomas. A pseudogene of this gene is located on the long arm of chromosome 8. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
Mouse(74513) neuropilin (NRP) and tolloid (TLL)-like 2
Rat(307757) neuropilin (NRP) and tolloid (TLL)-like 2
chicken(415743) neuropilin (NRP) and tolloid (TLL)-like 2
domestic cat(101093228) neuropilin (NRP) and tolloid (TLL)-like 2
cow(520056) neuropilin (NRP) and tolloid (TLL)-like 2
dog(478142) neuropilin (NRP) and tolloid (TLL)-like 2
sheep(101114803) neuropilin (NRP) and tolloid (TLL)-like 2
naked mole-rat(101700198) neuropilin (NRP) and tolloid (TLL)-like 2
domestic guinea pig(100724653) neuropilin (NRP) and tolloid (TLL)-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_134498 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_134498 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_134498 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018092 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018092 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018092 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018092 Rosetta Predictions human pricing
NM_001107417 Rosetta Predictions rat pricing
NM_001081324 Rosetta Predictions mouse pricing
XM_134498 Rosetta Predictions mouse pricing
XM_894043 Rosetta Predictions mouse pricing
XM_901235 Rosetta Predictions mouse pricing
XM_901243 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018092 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351272 predicted 1940
2 SASI_Hs01_00011026 predicted 1444
3 SASI_Hs01_00011027 predicted 1954
4 SASI_Hs01_00011028 predicted 1750
5 SASI_Hs01_00011030 predicted 561
6 SASI_Hs01_00011031 predicted 1291
7 SASI_Hs01_00011033 predicted 945
8 SASI_Hs01_00011034 predicted 732
9 SASI_Hs01_00011035 predicted 906
10 SASI_Hs02_00351273 predicted 1418
11 SASI_Hs01_00011029 predicted 795
12 SASI_Hs01_00011032 predicted 1312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107417 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228615 predicted 632
2 SASI_Rn02_00228616 predicted 1187
3 SASI_Rn02_00228617 predicted 921
4 SASI_Rn02_00228618 predicted 1451
5 SASI_Rn02_00228619 predicted 755
6 SASI_Rn02_00228620 predicted 778
7 SASI_Rn02_00228621 predicted 1478
8 SASI_Rn02_00228622 predicted 1253
9 SASI_Rn02_00228623 predicted 1555
10 SASI_Rn02_00228624 predicted 1113
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081324 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297301 predicted 335
2 SASI_Mm02_00297302 predicted 1027
3 SASI_Mm02_00297303 predicted 1708
4 SASI_Mm02_00297304 predicted 1185
5 SASI_Mm02_00297305 predicted 1290
6 SASI_Mm02_00297306 predicted 1673
7 SASI_Mm02_00297307 predicted 889
8 SASI_Mm02_00297308 predicted 417
9 SASI_Mm02_00297309 predicted 1702
10 SASI_Mm02_00297310 predicted 1160
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_134498 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00269953 predicted 861
2 SASI_Mm01_00269954 predicted 504
3 SASI_Mm01_00269955 predicted 660
4 SASI_Mm01_00269956 predicted 1001
5 SASI_Mm01_00269957 predicted 536
6 SASI_Mm01_00269958 predicted 898
7 SASI_Mm01_00269959 predicted 715
8 SASI_Mm01_00269960 predicted 838
9 SASI_Mm01_00269961 predicted 602
10 SASI_Mm01_00269962 predicted 1476
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894043 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259391 predicted 348
2 SASI_Mm01_00259392 predicted 404
3 SASI_Mm01_00259393 predicted 396
4 SASI_Mm01_00259394 predicted 553
5 SASI_Mm01_00259395 predicted 897
6 SASI_Mm01_00259396 predicted 428
7 SASI_Mm01_00259397 predicted 785
8 SASI_Mm01_00259398 predicted 605
9 SASI_Mm01_00259399 predicted 742
10 SASI_Mm01_00259400 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901235 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272858 predicted 512
2 SASI_Mm01_00272859 predicted 1022
3 SASI_Mm01_00272860 predicted 1611
4 SASI_Mm01_00272861 predicted 1480
5 SASI_Mm01_00272862 predicted 977
6 SASI_Mm01_00272863 predicted 537
7 SASI_Mm01_00272864 predicted 523
8 SASI_Mm01_00272865 predicted 511
9 SASI_Mm01_00272866 predicted 1494
10 SASI_Mm01_00272867 predicted 1586
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901243 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00228897 predicted 946
2 SASI_Mm01_00228898 predicted 1521
3 SASI_Mm01_00228899 predicted 1401
4 SASI_Mm01_00228900 predicted 949
5 SASI_Mm01_00228901 predicted 904
6 SASI_Mm01_00228902 predicted 942
7 SASI_Mm01_00228903 predicted 1412
8 SASI_Mm01_00228904 predicted 1510
9 SASI_Mm01_00228905 predicted 1420
10 SASI_Mm01_00228906 predicted 1393
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_134498
NETO2 MISSION shRNA Bacterial Glycerol Stock
neuropilin (NRP) and tolloid (TLL)-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134498.6-522s1c1
Sequence:CCGGGCTATTATATAGAGCCATCATCTCGAGATGATGGCTCTATATAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_134498.6-1903s1c1
Sequence:CCGGGCCCTTCATAACTTATCATAACTCGAGTTATGATAAGTTATGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134498.6-1784s1c1
Sequence:CCGGGCATCCATATCCATCGACTTTCTCGAGAAAGTCGATGGATATGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134498.6-648s1c1
Sequence:CCGGCGGGAAGATTCATGTGGATTACTCGAGTAATCCACATGAATCTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134498.6-947s1c1
Sequence:CCGGGCAGTCTATGATGGAAGCAGTCTCGAGACTGCTTCCATCATAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_134498
NETO2 MISSION shRNA shRNA Plasmid DNA
neuropilin (NRP) and tolloid (TLL)-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134498.6-522s1c1
Sequence:CCGGGCTATTATATAGAGCCATCATCTCGAGATGATGGCTCTATATAATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_134498.6-1903s1c1
Sequence:CCGGGCCCTTCATAACTTATCATAACTCGAGTTATGATAAGTTATGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134498.6-1784s1c1
Sequence:CCGGGCATCCATATCCATCGACTTTCTCGAGAAAGTCGATGGATATGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134498.6-648s1c1
Sequence:CCGGCGGGAAGATTCATGTGGATTACTCGAGTAATCCACATGAATCTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134498.6-947s1c1
Sequence:CCGGGCAGTCTATGATGGAAGCAGTCTCGAGACTGCTTCCATCATAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_134498
NETO2 MISSION shRNA Lentiviral Transduction Particles
neuropilin (NRP) and tolloid (TLL)-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134498.6-522s1c1
Sequence:CCGGGCTATTATATAGAGCCATCATCTCGAGATGATGGCTCTATATAATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_134498.6-1903s1c1
Sequence:CCGGGCCCTTCATAACTTATCATAACTCGAGTTATGATAAGTTATGAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134498.6-1784s1c1
Sequence:CCGGGCATCCATATCCATCGACTTTCTCGAGAAAGTCGATGGATATGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134498.6-648s1c1
Sequence:CCGGCGGGAAGATTCATGTGGATTACTCGAGTAATCCACATGAATCTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134498.6-947s1c1
Sequence:CCGGGCAGTCTATGATGGAAGCAGTCTCGAGACTGCTTCCATCATAGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018092
VALIDATED
NETO2 MISSION shRNA Bacterial Glycerol Stock
neuropilin (NRP) and tolloid (TLL)-like 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018092.3-3343s1c1
Sequence:CCGGGCTCTAAATCACTACACAAATCTCGAGATTTGTGTAGTGATTTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018092.3-671s1c1
Sequence:CCGGCCATCATTTGAGTGTCGGTTTCTCGAGAAACCGACACTCAAATGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018092.3-1163s1c1
Sequence:CCGGGCCAATGATGTAATGCTTAAACTCGAGTTTAAGCATTACATCATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018092.3-1568s1c1
Sequence:CCGGCCTCCTCATTATGAACTGTTTCTCGAGAAACAGTTCATAATGAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_018092.3-561s1c1
Sequence:CCGGCGCCAAATTATCCTGACTCATCTCGAGATGAGTCAGGATAATTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018092.3-671s21c1
Sequence:CCGGCCATCATTTGAGTGTCGGTTTCTCGAGAAACCGACACTCAAATGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_018092.3-1568s21c1
Sequence:CCGGCCTCCTCATTATGAACTGTTTCTCGAGAAACAGTTCATAATGAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_018092.3-1163s21c1
Sequence:CCGGGCCAATGATGTAATGCTTAAACTCGAGTTTAAGCATTACATCATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_018092.3-3343s21c1
Sequence:CCGGGCTCTAAATCACTACACAAATCTCGAGATTTGTGTAGTGATTTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018092.3-561s21c1
Sequence:CCGGCGCCAAATTATCCTGACTCATCTCGAGATGAGTCAGGATAATTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018092
VALIDATED
NETO2 MISSION shRNA shRNA Plasmid DNA
neuropilin (NRP) and tolloid (TLL)-like 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018092.3-3343s1c1
Sequence:CCGGGCTCTAAATCACTACACAAATCTCGAGATTTGTGTAGTGATTTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018092.3-671s1c1
Sequence:CCGGCCATCATTTGAGTGTCGGTTTCTCGAGAAACCGACACTCAAATGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018092.3-1163s1c1
Sequence:CCGGGCCAATGATGTAATGCTTAAACTCGAGTTTAAGCATTACATCATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018092.3-1568s1c1
Sequence:CCGGCCTCCTCATTATGAACTGTTTCTCGAGAAACAGTTCATAATGAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_018092.3-561s1c1
Sequence:CCGGCGCCAAATTATCCTGACTCATCTCGAGATGAGTCAGGATAATTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018092.3-671s21c1
Sequence:CCGGCCATCATTTGAGTGTCGGTTTCTCGAGAAACCGACACTCAAATGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_018092.3-1568s21c1
Sequence:CCGGCCTCCTCATTATGAACTGTTTCTCGAGAAACAGTTCATAATGAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_018092.3-1163s21c1
Sequence:CCGGGCCAATGATGTAATGCTTAAACTCGAGTTTAAGCATTACATCATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_018092.3-3343s21c1
Sequence:CCGGGCTCTAAATCACTACACAAATCTCGAGATTTGTGTAGTGATTTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018092.3-561s21c1
Sequence:CCGGCGCCAAATTATCCTGACTCATCTCGAGATGAGTCAGGATAATTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018092
VALIDATED
NETO2 MISSION shRNA Lentiviral Transduction Particles
neuropilin (NRP) and tolloid (TLL)-like 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018092.3-3343s1c1
Sequence:CCGGGCTCTAAATCACTACACAAATCTCGAGATTTGTGTAGTGATTTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018092.3-671s1c1
Sequence:CCGGCCATCATTTGAGTGTCGGTTTCTCGAGAAACCGACACTCAAATGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018092.3-1163s1c1
Sequence:CCGGGCCAATGATGTAATGCTTAAACTCGAGTTTAAGCATTACATCATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018092.3-1568s1c1
Sequence:CCGGCCTCCTCATTATGAACTGTTTCTCGAGAAACAGTTCATAATGAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_018092.3-561s1c1
Sequence:CCGGCGCCAAATTATCCTGACTCATCTCGAGATGAGTCAGGATAATTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018092.3-671s21c1
Sequence:CCGGCCATCATTTGAGTGTCGGTTTCTCGAGAAACCGACACTCAAATGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_018092.3-1568s21c1
Sequence:CCGGCCTCCTCATTATGAACTGTTTCTCGAGAAACAGTTCATAATGAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_018092.3-1163s21c1
Sequence:CCGGGCCAATGATGTAATGCTTAAACTCGAGTTTAAGCATTACATCATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_018092.3-3343s21c1
Sequence:CCGGGCTCTAAATCACTACACAAATCTCGAGATTTGTGTAGTGATTTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018092.3-561s21c1
Sequence:CCGGCGCCAAATTATCCTGACTCATCTCGAGATGAGTCAGGATAATTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)