EMAIL THIS PAGE TO A FRIEND

NEU1

sialidase 1 (lysosomal sialidase)

101 Gene Product Result for
Synonyms: NANH NEU SIAL1
UniProtKB ID: Q99519
Gene ID:
Human(4758) Summary: The protein encoded by this gene is a lysosomal enzyme that cleaves terminal sialic acid residues from substrates such as glycoproteins and glycolipids. In the lysosome, this enzyme is part of a heterotrimeric complex together with beta-galactosidase and cathepsin A (the latter is also referred to as 'protective protein'). Mutations in this gene can lead to sialidosis, a lysosomal storage disease that can be type 1 (cherry red spot-myoclonus syndrome or normosomatic type), which is late-onset, or type 2 (the dysmorphic type), which occurs at an earlier age with increased severity. [provided by RefSeq, Jul 2008]
Mouse(18010) neuraminidase 1
Rat(24591) neuraminidase 1
domestic guinea pig(100728899) sialidase 1 (lysosomal sialidase)
naked mole-rat(101699194) sialidase 1 (lysosomal sialidase)
Domestic Rabbit(100342130) sialidase 1 (lysosomal sialidase)
sheep(101116435) sialidase 1 (lysosomal sialidase)
Zebrafish(559850) neuraminidase 1
cow(505554) sialidase 1 (lysosomal sialidase)
Horse(100059083) sialidase 1 (lysosomal sialidase)
domestic cat(101091282) sialidase 1 (lysosomal sialidase)
dog(481717) sialidase 1 (lysosomal sialidase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000434 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000434 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000434 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010893 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010893 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010893 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000434 Rosetta Predictions human pricing
NM_031522 Rosetta Predictions rat pricing
NM_010893 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052888 predicted 1513
2 SASI_Hs01_00052890 predicted 997
3 SASI_Hs01_00052891 predicted 401
4 SASI_Hs01_00052892 predicted 1585
5 SASI_Hs01_00052893 predicted 677
6 SASI_Hs02_00302543 predicted 1006
7 SASI_Hs01_00052894 predicted 332
8 SASI_Hs01_00052895 predicted 1523
9 SASI_Hs01_00052896 predicted 560
10 SASI_Hs01_00052897 predicted 1232
11 SASI_Hs01_00052889 predicted 1013
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031522 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033207 predicted 1281
2 SASI_Rn01_00033209 predicted 400
3 SASI_Rn01_00033210 predicted 1199
4 SASI_Rn02_00264653 predicted 1015
5 SASI_Rn01_00033213 predicted 750
6 SASI_Rn01_00033214 predicted 794
7 SASI_Rn01_00033215 predicted 584
8 SASI_Rn01_00033216 predicted 1218
9 SASI_Rn02_00264654 predicted 1050
10 SASI_Rn02_00264655 predicted 506
11 SASI_Rn01_00033208 predicted 478
12 SASI_Rn01_00033211 predicted 672
13 SASI_Rn01_00033212 predicted 907
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010893 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142739 predicted 501
2 SASI_Mm01_00142740 predicted 1196
3 SASI_Mm02_00319602 predicted 642
4 SASI_Mm01_00142741 predicted 1165
5 SASI_Mm02_00319603 predicted 563
6 SASI_Mm02_00319604 predicted 734
7 SASI_Mm01_00142742 predicted 878
8 SASI_Mm01_00142743 predicted 820
9 SASI_Mm01_00142745 predicted 514
10 SASI_Mm01_00142747 predicted 557
11 SASI_Mm01_00142744 predicted 994
12 SASI_Mm01_00142746 predicted 767
13 SASI_Mm01_00142748 predicted 483
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000434
VALIDATED
NEU1 MISSION shRNA Bacterial Glycerol Stock
sialidase 1 (lysosomal sialidase)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000434.3-591s21c1
Sequence:CCGGTGTTGAGACAGGAGTAGTATTCTCGAGAATACTACTCCTGTCTCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000434.3-707s21c1
Sequence:CCGGCCCGGAATCTCTCCCTGGATACTCGAGTATCCAGGGAGAGATTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000434.3-1321s21c1
Sequence:CCGGCTCTACGTCCTGTATGAGAAACTCGAGTTTCTCATACAGGACGTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000434.3-1767s21c1
Sequence:CCGGTTTGGTGTTGCGGTAAGATAACTCGAGTTATCTTACCGCAACACCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000434.3-1202s21c1
Sequence:CCGGGCTTCAGCAATGGTACCTCATCTCGAGATGAGGTACCATTGCTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000434.2-1510s1c1
Sequence:CCGGCCTTCCCTTTACCAGGGAAATCTCGAGATTTCCCTGGTAAAGGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000434.2-681s1c1
Sequence:CCGGCCCGGAATCTCTCCCTGGATACTCGAGTATCCAGGGAGAGATTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000434.2-1295s1c1
Sequence:CCGGCTCTACGTCCTGTATGAGAAACTCGAGTTTCTCATACAGGACGTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000434.2-682s1c1
Sequence:CCGGCCGGAATCTCTCCCTGGATATCTCGAGATATCCAGGGAGAGATTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000434.2-1176s1c1
Sequence:CCGGGCTTCAGCAATGGTACCTCATCTCGAGATGAGGTACCATTGCTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000434
VALIDATED
NEU1 MISSION shRNA shRNA Plasmid DNA
sialidase 1 (lysosomal sialidase)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000434.3-591s21c1
Sequence:CCGGTGTTGAGACAGGAGTAGTATTCTCGAGAATACTACTCCTGTCTCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000434.3-707s21c1
Sequence:CCGGCCCGGAATCTCTCCCTGGATACTCGAGTATCCAGGGAGAGATTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000434.3-1321s21c1
Sequence:CCGGCTCTACGTCCTGTATGAGAAACTCGAGTTTCTCATACAGGACGTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000434.3-1767s21c1
Sequence:CCGGTTTGGTGTTGCGGTAAGATAACTCGAGTTATCTTACCGCAACACCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000434.3-1202s21c1
Sequence:CCGGGCTTCAGCAATGGTACCTCATCTCGAGATGAGGTACCATTGCTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000434.2-1510s1c1
Sequence:CCGGCCTTCCCTTTACCAGGGAAATCTCGAGATTTCCCTGGTAAAGGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000434.2-681s1c1
Sequence:CCGGCCCGGAATCTCTCCCTGGATACTCGAGTATCCAGGGAGAGATTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000434.2-1295s1c1
Sequence:CCGGCTCTACGTCCTGTATGAGAAACTCGAGTTTCTCATACAGGACGTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000434.2-682s1c1
Sequence:CCGGCCGGAATCTCTCCCTGGATATCTCGAGATATCCAGGGAGAGATTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000434.2-1176s1c1
Sequence:CCGGGCTTCAGCAATGGTACCTCATCTCGAGATGAGGTACCATTGCTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000434
VALIDATED
NEU1 MISSION shRNA Lentiviral Transduction Particles
sialidase 1 (lysosomal sialidase)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000434.3-591s21c1
Sequence:CCGGTGTTGAGACAGGAGTAGTATTCTCGAGAATACTACTCCTGTCTCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000434.3-707s21c1
Sequence:CCGGCCCGGAATCTCTCCCTGGATACTCGAGTATCCAGGGAGAGATTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000434.3-1321s21c1
Sequence:CCGGCTCTACGTCCTGTATGAGAAACTCGAGTTTCTCATACAGGACGTAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000434.3-1767s21c1
Sequence:CCGGTTTGGTGTTGCGGTAAGATAACTCGAGTTATCTTACCGCAACACCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000434.3-1202s21c1
Sequence:CCGGGCTTCAGCAATGGTACCTCATCTCGAGATGAGGTACCATTGCTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000434.2-1510s1c1
Sequence:CCGGCCTTCCCTTTACCAGGGAAATCTCGAGATTTCCCTGGTAAAGGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000434.2-681s1c1
Sequence:CCGGCCCGGAATCTCTCCCTGGATACTCGAGTATCCAGGGAGAGATTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000434.2-1295s1c1
Sequence:CCGGCTCTACGTCCTGTATGAGAAACTCGAGTTTCTCATACAGGACGTAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000434.2-682s1c1
Sequence:CCGGCCGGAATCTCTCCCTGGATATCTCGAGATATCCAGGGAGAGATTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000434.2-1176s1c1
Sequence:CCGGGCTTCAGCAATGGTACCTCATCTCGAGATGAGGTACCATTGCTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010893
NEU1 MISSION shRNA Bacterial Glycerol Stock
sialidase 1 (lysosomal sialidase)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010893.2-1547s1c1
Sequence:CCGGCCCTGGAGAGATGAACAGATACTCGAGTATCTGTTCATCTCTCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010893.2-848s1c1
Sequence:CCGGCGGAACCAGAATAACTACCATCTCGAGATGGTAGTTATTCTGGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010893.2-1174s1c1
Sequence:CCGGGCTGTTCGTTCTGTACGAGAACTCGAGTTCTCGTACAGAACGAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010893.2-847s1c1
Sequence:CCGGCCGGAACCAGAATAACTACCACTCGAGTGGTAGTTATTCTGGTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010893.2-991s1c1
Sequence:CCGGCGGCATTGTCTTCTTCTCCAACTCGAGTTGGAGAAGAAGACAATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010893
NEU1 MISSION shRNA shRNA Plasmid DNA
sialidase 1 (lysosomal sialidase)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010893.2-1547s1c1
Sequence:CCGGCCCTGGAGAGATGAACAGATACTCGAGTATCTGTTCATCTCTCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010893.2-848s1c1
Sequence:CCGGCGGAACCAGAATAACTACCATCTCGAGATGGTAGTTATTCTGGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010893.2-1174s1c1
Sequence:CCGGGCTGTTCGTTCTGTACGAGAACTCGAGTTCTCGTACAGAACGAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010893.2-847s1c1
Sequence:CCGGCCGGAACCAGAATAACTACCACTCGAGTGGTAGTTATTCTGGTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010893.2-991s1c1
Sequence:CCGGCGGCATTGTCTTCTTCTCCAACTCGAGTTGGAGAAGAAGACAATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010893
NEU1 MISSION shRNA Lentiviral Transduction Particles
sialidase 1 (lysosomal sialidase)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010893.2-1547s1c1
Sequence:CCGGCCCTGGAGAGATGAACAGATACTCGAGTATCTGTTCATCTCTCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010893.2-848s1c1
Sequence:CCGGCGGAACCAGAATAACTACCATCTCGAGATGGTAGTTATTCTGGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010893.2-1174s1c1
Sequence:CCGGGCTGTTCGTTCTGTACGAGAACTCGAGTTCTCGTACAGAACGAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010893.2-847s1c1
Sequence:CCGGCCGGAACCAGAATAACTACCACTCGAGTGGTAGTTATTCTGGTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010893.2-991s1c1
Sequence:CCGGCGGCATTGTCTTCTTCTCCAACTCGAGTTGGAGAAGAAGACAATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)