EMAIL THIS PAGE TO A FRIEND

NEU2

sialidase 2 (cytosolic sialidase)

49 Gene Product Result for
Synonyms: SIAL2
UniProtKB ID: Q9Y3R4, Q3KNW4, Q6NTB4
Gene ID:
Human(4759) Summary: This gene belongs to a family of glycohydrolytic enzymes which remove sialic acid residues from glycoproteins and glycolipids. Expression studies in COS7 cells confirmed that this gene encodes a functional sialidase. Its cytosolic localization was demonstrated by cell fractionation experiments. [provided by RefSeq, Jul 2008]
Mouse(23956) neuraminidase 2
Rat(29204) sialidase 2
fruit fly(40375) Neuroectoderm-expressed 2
chicken(768823) sialidase 2 (cytosolic sialidase)
domestic cat(101085144) sialidase 2 (cytosolic sialidase)
cow(614542) sialidase 2 (cytosolic sialidase)
dog(486166) sialidase 2 (cytosolic sialidase)
sheep(101113191) sialidase 2 (cytosolic sialidase)
naked mole-rat(101698605) sialidase 2 (cytosolic sialidase)
domestic guinea pig(100723011) sialidase 2 (cytosolic sialidase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005383 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005383 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005383 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015750 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015750 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015750 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU148391 MISSION® esiRNA esiRNA targeting mouse Neu2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005383 Rosetta Predictions human pricing
NM_017130 Rosetta Predictions rat pricing
NM_015750 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005383 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018134 predicted 744
2 SASI_Hs01_00018136 predicted 694
3 SASI_Hs01_00018137 predicted 739
4 SASI_Hs01_00018138 predicted 753
5 SASI_Hs01_00018139 predicted 191
6 SASI_Hs01_00018140 predicted 684
7 SASI_Hs02_00339500 predicted 580
8 SASI_Hs01_00018141 predicted 344
9 SASI_Hs01_00018142 predicted 765
10 SASI_Hs01_00018143 predicted 747
11 SASI_Hs01_00018135 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017130 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085581 predicted 1255
2 SASI_Rn01_00085579 predicted 964
3 SASI_Rn01_00085580 predicted 927
4 SASI_Rn02_00261368 predicted 1235
5 SASI_Rn01_00085583 predicted 540
6 SASI_Rn02_00261369 predicted 1032
7 SASI_Rn01_00085584 predicted 529
8 SASI_Rn01_00085585 predicted 1402
9 SASI_Rn01_00085586 predicted 335
10 SASI_Rn02_00261370 predicted 871
11 SASI_Rn01_00085577 predicted 724
12 SASI_Rn01_00085578 predicted 1039
13 SASI_Rn01_00085582 predicted 1250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015750 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077845 predicted 1133
2 SASI_Mm01_00077846 predicted 915
3 SASI_Mm01_00077847 predicted 415
4 SASI_Mm01_00077848 predicted 823
5 SASI_Mm01_00077849 predicted 1116
6 SASI_Mm01_00077850 predicted 599
7 SASI_Mm01_00077851 predicted 1306
8 SASI_Mm01_00077852 predicted 680
9 SASI_Mm01_00077853 predicted 940
10 SASI_Mm01_00077854 predicted 328
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005383
NEU2 MISSION shRNA Bacterial Glycerol Stock
sialidase 2 (cytosolic sialidase)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005383.1-756s1c1
Sequence:CCGGGCTTGATTTCCAGGAGTCTCACTCGAGTGAGACTCCTGGAAATCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005383.1-298s1c1
Sequence:CCGGCTCTTCTTCATTGCCATCCCTCTCGAGAGGGATGGCAATGAAGAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005383.1-767s21c1
Sequence:CCGGAGGAGTCTCAGCTGGTGAAGACTCGAGTCTTCACCAGCTGAGACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005383.1-744s21c1
Sequence:CCGGCACCAATGACGGGCTTGATTTCTCGAGAAATCAAGCCCGTCATTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005383.1-451s21c1
Sequence:CCGGTACCGGGAGTGGTCCACCTTTCTCGAGAAAGGTGGACCACTCCCGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005383.1-484s21c1
Sequence:CCGGGGGCATTGTTTGCAGCTTAACCTCGAGGTTAAGCTGCAAACAATGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005383
NEU2 MISSION shRNA shRNA Plasmid DNA
sialidase 2 (cytosolic sialidase)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005383.1-756s1c1
Sequence:CCGGGCTTGATTTCCAGGAGTCTCACTCGAGTGAGACTCCTGGAAATCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005383.1-298s1c1
Sequence:CCGGCTCTTCTTCATTGCCATCCCTCTCGAGAGGGATGGCAATGAAGAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005383.1-767s21c1
Sequence:CCGGAGGAGTCTCAGCTGGTGAAGACTCGAGTCTTCACCAGCTGAGACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005383.1-744s21c1
Sequence:CCGGCACCAATGACGGGCTTGATTTCTCGAGAAATCAAGCCCGTCATTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005383.1-451s21c1
Sequence:CCGGTACCGGGAGTGGTCCACCTTTCTCGAGAAAGGTGGACCACTCCCGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005383.1-484s21c1
Sequence:CCGGGGGCATTGTTTGCAGCTTAACCTCGAGGTTAAGCTGCAAACAATGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005383
NEU2 MISSION shRNA Lentiviral Transduction Particles
sialidase 2 (cytosolic sialidase)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005383.1-756s1c1
Sequence:CCGGGCTTGATTTCCAGGAGTCTCACTCGAGTGAGACTCCTGGAAATCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005383.1-298s1c1
Sequence:CCGGCTCTTCTTCATTGCCATCCCTCTCGAGAGGGATGGCAATGAAGAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005383.1-767s21c1
Sequence:CCGGAGGAGTCTCAGCTGGTGAAGACTCGAGTCTTCACCAGCTGAGACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005383.1-744s21c1
Sequence:CCGGCACCAATGACGGGCTTGATTTCTCGAGAAATCAAGCCCGTCATTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005383.1-451s21c1
Sequence:CCGGTACCGGGAGTGGTCCACCTTTCTCGAGAAAGGTGGACCACTCCCGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005383.1-484s21c1
Sequence:CCGGGGGCATTGTTTGCAGCTTAACCTCGAGGTTAAGCTGCAAACAATGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015750
NEU2 MISSION shRNA Bacterial Glycerol Stock
sialidase 2 (cytosolic sialidase)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015750.1-1337s1c1
Sequence:CCGGGCAGAGAATTTGGTCTCTTGACTCGAGTCAAGAGACCAAATTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015750.1-344s1c1
Sequence:CCGGGTCCCTTGTATGACAAGCAAACTCGAGTTTGCTTGTCATACAAGGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015750.1-690s1c1
Sequence:CCGGGCACACATGGAAACTAGGCAACTCGAGTTGCCTAGTTTCCATGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015750.1-824s1c1
Sequence:CCGGGTCCTAATGATGGTCTGGATTCTCGAGAATCCAGACCATCATTAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015750.1-347s1c1
Sequence:CCGGCCTTGTATGACAAGCAAACAACTCGAGTTGTTTGCTTGTCATACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015750
NEU2 MISSION shRNA shRNA Plasmid DNA
sialidase 2 (cytosolic sialidase)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015750.1-1337s1c1
Sequence:CCGGGCAGAGAATTTGGTCTCTTGACTCGAGTCAAGAGACCAAATTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015750.1-344s1c1
Sequence:CCGGGTCCCTTGTATGACAAGCAAACTCGAGTTTGCTTGTCATACAAGGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015750.1-690s1c1
Sequence:CCGGGCACACATGGAAACTAGGCAACTCGAGTTGCCTAGTTTCCATGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015750.1-824s1c1
Sequence:CCGGGTCCTAATGATGGTCTGGATTCTCGAGAATCCAGACCATCATTAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015750.1-347s1c1
Sequence:CCGGCCTTGTATGACAAGCAAACAACTCGAGTTGTTTGCTTGTCATACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015750
NEU2 MISSION shRNA Lentiviral Transduction Particles
sialidase 2 (cytosolic sialidase)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015750.1-1337s1c1
Sequence:CCGGGCAGAGAATTTGGTCTCTTGACTCGAGTCAAGAGACCAAATTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015750.1-344s1c1
Sequence:CCGGGTCCCTTGTATGACAAGCAAACTCGAGTTTGCTTGTCATACAAGGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015750.1-690s1c1
Sequence:CCGGGCACACATGGAAACTAGGCAACTCGAGTTGCCTAGTTTCCATGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015750.1-824s1c1
Sequence:CCGGGTCCTAATGATGGTCTGGATTCTCGAGAATCCAGACCATCATTAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015750.1-347s1c1
Sequence:CCGGCCTTGTATGACAAGCAAACAACTCGAGTTGTTTGCTTGTCATACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)