EMAIL THIS PAGE TO A FRIEND

NEU4

sialidase 4

47 Gene Product Result for
UniProtKB ID: Q8WWR8, A8K056, J3KNJ5, Q96D64
Gene ID:
Human(129807) Summary: The protein encoded by this gene belongs to a family of glycohydrolytic enzymes, which remove terminal sialic acid residues from various sialo derivatives, such as glycoproteins, glycolipids, oligosaccharides, and gangliosides. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Nov 2009]
Mouse(241159) sialidase 4
Rat(316642) sialidase 4
Zebrafish(553569) sialidase 4
cow(528030) sialidase 4
dog(609668) sialidase 4
chicken(429131) sialidase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173772 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173772 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173772 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080741 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080741 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080741 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080741 Rosetta Predictions human pricing
NM_001108234 Rosetta Predictions rat pricing
NM_173772 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080741 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151880 predicted 944
2 SASI_Hs02_00362527 predicted 1257
3 SASI_Hs01_00151881 predicted 819
4 SASI_Hs01_00151882 predicted 515
5 SASI_Hs01_00151883 predicted 1222
6 SASI_Hs01_00151884 predicted 1078
7 SASI_Hs01_00151886 predicted 1738
8 SASI_Hs01_00151887 predicted 825
9 SASI_Hs01_00151888 predicted 1047
10 SASI_Hs02_00362528 predicted 1700
11 SASI_Hs01_00151879 predicted 1075
12 SASI_Hs01_00151885 predicted 1623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108234 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236644 predicted 377
2 SASI_Rn02_00236645 predicted 859
3 SASI_Rn02_00236646 predicted 911
4 SASI_Rn02_00236647 predicted 1484
5 SASI_Rn02_00236648 predicted 1558
6 SASI_Rn02_00236649 predicted 1538
7 SASI_Rn02_00236650 predicted 499
8 SASI_Rn02_00236651 predicted 1035
9 SASI_Rn02_00236652 predicted 1075
10 SASI_Rn02_00236653 predicted 1095
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173772 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183301 predicted 1188
2 SASI_Mm01_00183302 predicted 363
3 SASI_Mm01_00183303 predicted 1543
4 SASI_Mm02_00345425 predicted 565
5 SASI_Mm01_00183304 predicted 442
6 SASI_Mm01_00183305 predicted 1467
7 SASI_Mm01_00183306 predicted 901
8 SASI_Mm01_00183307 predicted 836
9 SASI_Mm01_00183308 predicted 1529
10 SASI_Mm01_00183309 predicted 1518
11 SASI_Mm01_00183300 predicted 1072
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173772
NEU4 MISSION shRNA Bacterial Glycerol Stock
sialidase 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173772.3-1954s1c1
Sequence:CCGGGCCACTTTGAAACATGCTGATCTCGAGATCAGCATGTTTCAAAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173772.3-1106s1c1
Sequence:CCGGCCAGAGGTCTTCTTGAACGTTCTCGAGAACGTTCAAGAAGACCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173772.3-269s1c1
Sequence:CCGGCCTTCGCGGAACAGCGACTTACTCGAGTAAGTCGCTGTTCCGCGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173772.3-1532s1c1
Sequence:CCGGCCACTGGCTTAGAGATGCTAACTCGAGTTAGCATCTCTAAGCCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173772.3-1063s1c1
Sequence:CCGGCCATGCTTCAATCTCAGAGTACTCGAGTACTCTGAGATTGAAGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173772
NEU4 MISSION shRNA shRNA Plasmid DNA
sialidase 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173772.3-1954s1c1
Sequence:CCGGGCCACTTTGAAACATGCTGATCTCGAGATCAGCATGTTTCAAAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173772.3-1106s1c1
Sequence:CCGGCCAGAGGTCTTCTTGAACGTTCTCGAGAACGTTCAAGAAGACCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173772.3-269s1c1
Sequence:CCGGCCTTCGCGGAACAGCGACTTACTCGAGTAAGTCGCTGTTCCGCGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173772.3-1532s1c1
Sequence:CCGGCCACTGGCTTAGAGATGCTAACTCGAGTTAGCATCTCTAAGCCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173772.3-1063s1c1
Sequence:CCGGCCATGCTTCAATCTCAGAGTACTCGAGTACTCTGAGATTGAAGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173772
NEU4 MISSION shRNA Lentiviral Transduction Particles
sialidase 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173772.3-1954s1c1
Sequence:CCGGGCCACTTTGAAACATGCTGATCTCGAGATCAGCATGTTTCAAAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173772.3-1106s1c1
Sequence:CCGGCCAGAGGTCTTCTTGAACGTTCTCGAGAACGTTCAAGAAGACCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173772.3-269s1c1
Sequence:CCGGCCTTCGCGGAACAGCGACTTACTCGAGTAAGTCGCTGTTCCGCGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173772.3-1532s1c1
Sequence:CCGGCCACTGGCTTAGAGATGCTAACTCGAGTTAGCATCTCTAAGCCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173772.3-1063s1c1
Sequence:CCGGCCATGCTTCAATCTCAGAGTACTCGAGTACTCTGAGATTGAAGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080741
NEU4 MISSION shRNA Bacterial Glycerol Stock
sialidase 4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182972    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080741.1-2041s1c1
Sequence:CCGGCAAGATCCTGTGGATTAGAAACTCGAGTTTCTAATCCACAGGATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080741.1-775s1c1
Sequence:CCGGCACCGTCTTCCTCTTCTTCATCTCGAGATGAAGAAGAGGAAGACGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080741.1-1079s21c1
Sequence:CCGGTTCGCCTTCTACAGCGATGACCTCGAGGTCATCGCTGTAGAAGGCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080741.1-2082s21c1
Sequence:CCGGTCAAGCAGGGACTGCTCTTTACTCGAGTAAAGAGCAGTCCCTGCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080741.1-1818s21c1
Sequence:CCGGGGACCTCCTATGATGAGATTTCTCGAGAAATCTCATCATAGGAGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080741.1-1360s21c1
Sequence:CCGGACGGGATGACAGTTGGTCAGTCTCGAGACTGACCAACTGTCATCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080741
NEU4 MISSION shRNA shRNA Plasmid DNA
sialidase 4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182972    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080741.1-2041s1c1
Sequence:CCGGCAAGATCCTGTGGATTAGAAACTCGAGTTTCTAATCCACAGGATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080741.1-775s1c1
Sequence:CCGGCACCGTCTTCCTCTTCTTCATCTCGAGATGAAGAAGAGGAAGACGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080741.1-1079s21c1
Sequence:CCGGTTCGCCTTCTACAGCGATGACCTCGAGGTCATCGCTGTAGAAGGCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080741.1-2082s21c1
Sequence:CCGGTCAAGCAGGGACTGCTCTTTACTCGAGTAAAGAGCAGTCCCTGCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080741.1-1818s21c1
Sequence:CCGGGGACCTCCTATGATGAGATTTCTCGAGAAATCTCATCATAGGAGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080741.1-1360s21c1
Sequence:CCGGACGGGATGACAGTTGGTCAGTCTCGAGACTGACCAACTGTCATCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080741
NEU4 MISSION shRNA Lentiviral Transduction Particles
sialidase 4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182972    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080741.1-2041s1c1
Sequence:CCGGCAAGATCCTGTGGATTAGAAACTCGAGTTTCTAATCCACAGGATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080741.1-775s1c1
Sequence:CCGGCACCGTCTTCCTCTTCTTCATCTCGAGATGAAGAAGAGGAAGACGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080741.1-1079s21c1
Sequence:CCGGTTCGCCTTCTACAGCGATGACCTCGAGGTCATCGCTGTAGAAGGCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080741.1-2082s21c1
Sequence:CCGGTCAAGCAGGGACTGCTCTTTACTCGAGTAAAGAGCAGTCCCTGCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080741.1-1818s21c1
Sequence:CCGGGGACCTCCTATGATGAGATTTCTCGAGAAATCTCATCATAGGAGGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080741.1-1360s21c1
Sequence:CCGGACGGGATGACAGTTGGTCAGTCTCGAGACTGACCAACTGTCATCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)