EMAIL THIS PAGE TO A FRIEND

NEURL1B

neuralized homolog 1B (Drosophila)

67 Gene Product Result for
Synonyms: NEURL3 hNeur2 neur2
UniProtKB ID: A8MQ27, C9DQJ5, C9DQJ6, C9DQJ7
Gene ID:
Mouse(240055) neuralized homolog 1b (Drosophila)
Rat(303019) neuralized homolog 1B (Drosophila)
domestic guinea pig(100717668) neuralized homolog 1B (Drosophila)
naked mole-rat(101697768) neuralized homolog 1B (Drosophila)
sheep(101106545) neuralized homolog 1B (Drosophila)
Zebrafish(553620) neuralized homolog 1B (Drosophila)
cow(510912) neuralized homolog 1B (Drosophila)
domestic cat(101093663) neuralized homolog 1B (Drosophila)
dog(489118) neuralized homolog 1B (Drosophila)
chicken(427626) neuralized homolog 1B (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303030 ANTI-NEURL1B (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
flow cytometry, immunohistochemistry, western blot pricing
HPA037612 Anti-NEURL1B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001142651 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001142651 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001142651 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU223781 MISSION® esiRNA esiRNA targeting human NEURL1B human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_015355 Rosetta Predictions human pricing
XM_220274 Rosetta Predictions rat pricing
XR_008077 Rosetta Predictions rat pricing
NM_001081656 Rosetta Predictions mouse pricing
XM_139844 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_015355 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381152 predicted 2851
2 SASI_Hs02_00381153 predicted 2861
3 SASI_Hs02_00381154 predicted 287
4 SASI_Hs02_00381155 predicted 3005
5 SASI_Hs02_00381156 predicted 2968
6 SASI_Hs02_00381157 predicted 1085
7 SASI_Hs02_00381158 predicted 1096
8 SASI_Hs02_00381159 predicted 724
9 SASI_Hs02_00381160 predicted 310
10 SASI_Hs02_00381161 predicted 2982
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220274 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00164514 predicted 779
2 SASI_Rn01_00164515 predicted 4941
3 SASI_Rn01_00164516 predicted 4849
4 SASI_Rn01_00164517 predicted 3758
5 SASI_Rn01_00164518 predicted 3618
6 SASI_Rn01_00164519 predicted 1937
7 SASI_Rn01_00164520 predicted 4791
8 SASI_Rn01_00164521 predicted 3768
9 SASI_Rn01_00164522 predicted 4165
10 SASI_Rn01_00164523 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008077 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00416174 predicted 659
2 SASI_Rn01_00186866 predicted 670
3 SASI_Rn02_00416175 predicted 323
4 SASI_Rn01_00186868 predicted 662
5 SASI_Rn01_00186869 predicted 451
6 SASI_Rn01_00186872 predicted 483
7 SASI_Rn02_00416176 predicted 323
8 SASI_Rn02_00416177 predicted 523
9 SASI_Rn02_00416178 predicted 665
10 SASI_Rn02_00416179 predicted 229
11 SASI_Rn01_00186867 predicted 1351
12 SASI_Rn01_00186870 predicted 1270
13 SASI_Rn01_00186871 predicted 1381
14 SASI_Rn01_00186873 predicted 1301
15 SASI_Rn01_00186874 predicted 1545
16 SASI_Rn01_00186875 predicted 1189
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081656 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298843 predicted 315
2 SASI_Mm02_00298844 predicted 1327
3 SASI_Mm02_00298845 predicted 1300
4 SASI_Mm02_00298846 predicted 1266
5 SASI_Mm02_00298847 predicted 316
6 SASI_Mm02_00298848 predicted 1336
7 SASI_Mm02_00298849 predicted 1265
8 SASI_Mm02_00298850 predicted 516
9 SASI_Mm02_00298851 predicted 310
10 SASI_Mm02_00298852 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_139844 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00282500 predicted 662
2 SASI_Mm01_00282501 predicted 353
3 SASI_Mm01_00282502 predicted 656
4 SASI_Mm01_00282503 predicted 225
5 SASI_Mm01_00282504 predicted 889
6 SASI_Mm01_00282505 predicted 282
7 SASI_Mm01_00282506 predicted 704
8 SASI_Mm01_00282507 predicted 919
9 SASI_Mm01_00282508 predicted 859
10 SASI_Mm01_00282509 predicted 658
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001142651
NEURL1B MISSION shRNA Bacterial Glycerol Stock
neuralized homolog 1B (Drosophila)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142651.1-1765s21c1
Sequence:CCGGGGCCCATCAAGGACGTCATTACTCGAGTAATGACGTCCTTGATGGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142651.1-1490s21c1
Sequence:CCGGGGACGATAGTGATTCAGATATCTCGAGATATCTGAATCACTATCGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142651.1-1219s21c1
Sequence:CCGGTGCTCGACCGCAAAGAGTACTCTCGAGAGTACTCTTTGCGGTCGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001142651.1-5899s21c1
Sequence:CCGGCCTGGCATTTCTCGGTATTTACTCGAGTAAATACCGAGAAATGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142651.1-328s21c1
Sequence:CCGGTCTGCAATGGCGTCACGTTCACTCGAGTGAACGTGACGCCATTGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001142651
NEURL1B MISSION shRNA shRNA Plasmid DNA
neuralized homolog 1B (Drosophila)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142651.1-1765s21c1
Sequence:CCGGGGCCCATCAAGGACGTCATTACTCGAGTAATGACGTCCTTGATGGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142651.1-1490s21c1
Sequence:CCGGGGACGATAGTGATTCAGATATCTCGAGATATCTGAATCACTATCGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142651.1-1219s21c1
Sequence:CCGGTGCTCGACCGCAAAGAGTACTCTCGAGAGTACTCTTTGCGGTCGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001142651.1-5899s21c1
Sequence:CCGGCCTGGCATTTCTCGGTATTTACTCGAGTAAATACCGAGAAATGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142651.1-328s21c1
Sequence:CCGGTCTGCAATGGCGTCACGTTCACTCGAGTGAACGTGACGCCATTGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001142651
NEURL1B MISSION shRNA Lentiviral Transduction Particles
neuralized homolog 1B (Drosophila)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142651.1-1765s21c1
Sequence:CCGGGGCCCATCAAGGACGTCATTACTCGAGTAATGACGTCCTTGATGGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142651.1-1490s21c1
Sequence:CCGGGGACGATAGTGATTCAGATATCTCGAGATATCTGAATCACTATCGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142651.1-1219s21c1
Sequence:CCGGTGCTCGACCGCAAAGAGTACTCTCGAGAGTACTCTTTGCGGTCGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001142651.1-5899s21c1
Sequence:CCGGCCTGGCATTTCTCGGTATTTACTCGAGTAAATACCGAGAAATGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142651.1-328s21c1
Sequence:CCGGTCTGCAATGGCGTCACGTTCACTCGAGTGAACGTGACGCCATTGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)