EMAIL THIS PAGE TO A FRIEND

NEURL2

neuralized homolog 2 (Drosophila)

47 Gene Product Result for
Synonyms: C20orf163 OZZ OZZ-E3
UniProtKB ID: Q9BR09, Q3KR34
Gene ID:
Human(140825) Summary: This gene encodes a protein that is involved in the regulation of myofibril organization. This protein is likely the adaptor component of the E3 ubiquitin ligase complex in striated muscle, and it regulates the ubiquitin-mediated degradation of beta-catenin during myogenesis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jun 2013]
Mouse(415115) neuralized-like 2 (Drosophila)
Rat(311633) neuralized homolog 2 (Drosophila)
chicken(428162) neuralized homolog 2 (Drosophila)
cow(526835) neuralized homolog 2 (Drosophila)
domestic cat(101085792) neuralized homolog 2 (Drosophila)
dog(477248) neuralized homolog 2 (Drosophila)
sheep(101115726) neuralized homolog 2 (Drosophila)
naked mole-rat(101720135) neuralized homolog 2 (Drosophila)
domestic guinea pig(100720232) neuralized homolog 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080749 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080749 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080749 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001082974 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001082974 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001082974 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080749 Rosetta Predictions human pricing
NM_001107802 Rosetta Predictions rat pricing
NM_001082974 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080749 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152369 predicted 875
2 SASI_Hs01_00152370 predicted 957
3 SASI_Hs01_00152371 predicted 1025
4 SASI_Hs01_00152372 predicted 704
5 SASI_Hs01_00152373 predicted 695
6 SASI_Hs01_00152374 predicted 712
7 SASI_Hs01_00152375 predicted 679
8 SASI_Hs01_00152376 predicted 1020
9 SASI_Hs01_00152377 predicted 591
10 SASI_Hs01_00152378 predicted 772
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107802 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232415 predicted 718
2 SASI_Rn02_00232416 predicted 436
3 SASI_Rn02_00232417 predicted 623
4 SASI_Rn02_00232418 predicted 611
5 SASI_Rn02_00232419 predicted 517
6 SASI_Rn02_00232420 predicted 779
7 SASI_Rn02_00232421 predicted 727
8 SASI_Rn02_00232422 predicted 532
9 SASI_Rn02_00232423 predicted 531
10 SASI_Rn02_00232424 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082974 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299424 predicted 588
2 SASI_Mm02_00299425 predicted 338
3 SASI_Mm02_00299426 predicted 759
4 SASI_Mm02_00299427 predicted 648
5 SASI_Mm02_00299428 predicted 572
6 SASI_Mm02_00299429 predicted 479
7 SASI_Mm02_00299430 predicted 306
8 SASI_Mm02_00299431 predicted 665
9 SASI_Mm02_00299432 predicted 241
10 SASI_Mm02_00299433 predicted 382
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080749
NEURL2 MISSION shRNA Bacterial Glycerol Stock
neuralized homolog 2 (Drosophila)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080749.2-977s21c1
Sequence:CCGGACAAAGAGCGTGCGCCTTGTCCTCGAGGACAAGGCGCACGCTCTTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080749.2-950s21c1
Sequence:CCGGTACGCGGTGGTGGACGTGTTTCTCGAGAAACACGTCCACCACCGCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080749.2-962s21c1
Sequence:CCGGGACGTGTTTGCTTCCACAAAGCTCGAGCTTTGTGGAAGCAAACACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080749.2-714s21c1
Sequence:CCGGGCATTGAGCAGTTTCGCATTCCTCGAGGAATGCGAAACTGCTCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080749.2-698s1c1
Sequence:CCGGGTGGAACCATATCTGCGCATTCTCGAGAATGCGCAGATATGGTTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080749.2-1087s1c1
Sequence:CCGGCCACCTGCCCAAAGAACTTAACTCGAGTTAAGTTCTTTGGGCAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080749.2-1039s1c1
Sequence:CCGGCCTAGTGATACAAAGGAGCATCTCGAGATGCTCCTTTGTATCACTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080749.2-877s1c1
Sequence:CCGGCGACATGCACATCATCATCAACTCGAGTTGATGATGATGTGCATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080749
NEURL2 MISSION shRNA shRNA Plasmid DNA
neuralized homolog 2 (Drosophila)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080749.2-977s21c1
Sequence:CCGGACAAAGAGCGTGCGCCTTGTCCTCGAGGACAAGGCGCACGCTCTTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080749.2-950s21c1
Sequence:CCGGTACGCGGTGGTGGACGTGTTTCTCGAGAAACACGTCCACCACCGCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080749.2-962s21c1
Sequence:CCGGGACGTGTTTGCTTCCACAAAGCTCGAGCTTTGTGGAAGCAAACACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080749.2-714s21c1
Sequence:CCGGGCATTGAGCAGTTTCGCATTCCTCGAGGAATGCGAAACTGCTCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080749.2-698s1c1
Sequence:CCGGGTGGAACCATATCTGCGCATTCTCGAGAATGCGCAGATATGGTTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080749.2-1087s1c1
Sequence:CCGGCCACCTGCCCAAAGAACTTAACTCGAGTTAAGTTCTTTGGGCAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080749.2-1039s1c1
Sequence:CCGGCCTAGTGATACAAAGGAGCATCTCGAGATGCTCCTTTGTATCACTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080749.2-877s1c1
Sequence:CCGGCGACATGCACATCATCATCAACTCGAGTTGATGATGATGTGCATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080749
NEURL2 MISSION shRNA Lentiviral Transduction Particles
neuralized homolog 2 (Drosophila)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080749.2-977s21c1
Sequence:CCGGACAAAGAGCGTGCGCCTTGTCCTCGAGGACAAGGCGCACGCTCTTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080749.2-950s21c1
Sequence:CCGGTACGCGGTGGTGGACGTGTTTCTCGAGAAACACGTCCACCACCGCGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080749.2-962s21c1
Sequence:CCGGGACGTGTTTGCTTCCACAAAGCTCGAGCTTTGTGGAAGCAAACACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080749.2-714s21c1
Sequence:CCGGGCATTGAGCAGTTTCGCATTCCTCGAGGAATGCGAAACTGCTCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080749.2-698s1c1
Sequence:CCGGGTGGAACCATATCTGCGCATTCTCGAGAATGCGCAGATATGGTTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080749.2-1087s1c1
Sequence:CCGGCCACCTGCCCAAAGAACTTAACTCGAGTTAAGTTCTTTGGGCAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080749.2-1039s1c1
Sequence:CCGGCCTAGTGATACAAAGGAGCATCTCGAGATGCTCCTTTGTATCACTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080749.2-877s1c1
Sequence:CCGGCGACATGCACATCATCATCAACTCGAGTTGATGATGATGTGCATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001082974
NEURL2 MISSION shRNA Bacterial Glycerol Stock
neuralized homolog 2 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082974.1-980s21c1
Sequence:CCGGCCAAAGGACTGAAGGACTTCTCTCGAGAGAAGTCCTTCAGTCCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082974.1-887s21c1
Sequence:CCGGTGGAGTATGGCTTGCCATCTCCTCGAGGAGATGGCAAGCCATACTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082974.1-759s21c1
Sequence:CCGGCGCCGACATGCACATCATCATCTCGAGATGATGATGTGCATGTCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082974.1-353s21c1
Sequence:CCGGTTCTAGTGGAAATTGAGGAAACTCGAGTTTCCTCAATTTCCACTAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082974.1-836s21c1
Sequence:CCGGACGCTGTGGTAGATGTGTTTGCTCGAGCAAACACATCTACCACAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001082974
NEURL2 MISSION shRNA shRNA Plasmid DNA
neuralized homolog 2 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082974.1-980s21c1
Sequence:CCGGCCAAAGGACTGAAGGACTTCTCTCGAGAGAAGTCCTTCAGTCCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082974.1-887s21c1
Sequence:CCGGTGGAGTATGGCTTGCCATCTCCTCGAGGAGATGGCAAGCCATACTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082974.1-759s21c1
Sequence:CCGGCGCCGACATGCACATCATCATCTCGAGATGATGATGTGCATGTCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082974.1-353s21c1
Sequence:CCGGTTCTAGTGGAAATTGAGGAAACTCGAGTTTCCTCAATTTCCACTAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082974.1-836s21c1
Sequence:CCGGACGCTGTGGTAGATGTGTTTGCTCGAGCAAACACATCTACCACAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001082974
NEURL2 MISSION shRNA Lentiviral Transduction Particles
neuralized homolog 2 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082974.1-980s21c1
Sequence:CCGGCCAAAGGACTGAAGGACTTCTCTCGAGAGAAGTCCTTCAGTCCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082974.1-887s21c1
Sequence:CCGGTGGAGTATGGCTTGCCATCTCCTCGAGGAGATGGCAAGCCATACTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082974.1-759s21c1
Sequence:CCGGCGCCGACATGCACATCATCATCTCGAGATGATGATGTGCATGTCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082974.1-353s21c1
Sequence:CCGGTTCTAGTGGAAATTGAGGAAACTCGAGTTTCCTCAATTTCCACTAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082974.1-836s21c1
Sequence:CCGGACGCTGTGGTAGATGTGTTTGCTCGAGCAAACACATCTACCACAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)