EMAIL THIS PAGE TO A FRIEND

NEURL3

neuralized homolog 3 (Drosophila) pseudogene

81 Gene Product Result for
Synonyms: LINCR
UniProtKB ID: Q96EH8
Gene ID:
Mouse(214854) neuralized homolog 3 homolog (Drosophila)
Rat(316326) neuralized homolog 3 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302249 ANTI-NEURL3 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153408 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153408 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153408 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080535 Rosetta Predictions human pricing
XM_930227 Rosetta Predictions human pricing
XM_934488 Rosetta Predictions human pricing
NM_001014100 Rosetta Predictions rat pricing
NM_153408 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315787 predicted 1147
2 SASI_Hs02_00315788 predicted 616
3 SASI_Hs02_00315789 predicted 1186
4 SASI_Hs02_00315790 predicted 1206
5 SASI_Hs02_00315791 predicted 960
6 SASI_Hs02_00315792 predicted 839
7 SASI_Hs02_00315793 predicted 1219
8 SASI_Hs02_00315794 predicted 536
9 SASI_Hs02_00315795 predicted 622
10 SASI_Hs02_00315796 predicted 1155
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251739 predicted 1151
2 SASI_Hs01_00251740 predicted 618
3 SASI_Hs01_00251741 predicted 1187
4 SASI_Hs01_00251742 predicted 1221
5 SASI_Hs01_00251743 predicted 1212
6 SASI_Hs01_00251744 predicted 957
7 SASI_Hs01_00251745 predicted 831
8 SASI_Hs01_00251746 predicted 534
9 SASI_Hs01_00251747 predicted 621
10 SASI_Hs01_00251748 predicted 1160
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934488 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289526 predicted 1395
2 SASI_Hs01_00289527 predicted 1429
3 SASI_Hs01_00289528 predicted 1474
4 SASI_Hs01_00289529 predicted 1426
5 SASI_Hs01_00289530 predicted 1206
6 SASI_Hs01_00289531 predicted 1478
7 SASI_Hs01_00289532 predicted 1404
8 SASI_Hs01_00289533 predicted 1477
9 SASI_Hs01_00289534 predicted 1458
10 SASI_Hs01_00289535 predicted 1469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014100 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201537 predicted 804
2 SASI_Rn02_00201538 predicted 941
3 SASI_Rn01_00072658 predicted 1049
4 SASI_Rn01_00072659 predicted 980
5 SASI_Rn01_00072660 predicted 788
6 SASI_Rn01_00072661 predicted 999
7 SASI_Rn01_00072662 predicted 526
8 SASI_Rn01_00072663 predicted 702
9 SASI_Rn01_00072664 predicted 686
10 SASI_Rn01_00072665 predicted 825
11 SASI_Rn01_00072666 predicted 1097
12 SASI_Rn01_00072667 predicted 783
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153408 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343193 predicted 647
2 SASI_Mm01_00045125 predicted 1082
3 SASI_Mm01_00045124 predicted 1169
4 SASI_Mm02_00343194 predicted 1216
5 SASI_Mm02_00343195 predicted 420
6 SASI_Mm01_00045126 predicted 862
7 SASI_Mm01_00045127 predicted 1170
8 SASI_Mm01_00045128 predicted 681
9 SASI_Mm01_00045129 predicted 629
10 SASI_Mm01_00045131 predicted 591
11 SASI_Mm01_00045130 predicted 1310
12 SASI_Mm01_00045132 predicted 1103
13 SASI_Mm01_00045133 predicted 945
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153408
NEURL3 MISSION shRNA Bacterial Glycerol Stock
neuralized homolog 3 (Drosophila) pseudogene
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153408.1-619s1c1
Sequence:CCGGCCAGAGTCTGAAGTCATATCACTCGAGTGATATGACTTCAGACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153408.1-189s1c1
Sequence:CCGGGTTCCACGATGGTATCGTGTTCTCGAGAACACGATACCATCGTGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153408.1-731s1c1
Sequence:CCGGACATCTTCAAAGACACGGCCACTCGAGTGGCCGTGTCTTTGAAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153408.1-564s1c1
Sequence:CCGGCATTGAGCTTCTGGATCCCAACTCGAGTTGGGATCCAGAAGCTCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153408.1-441s1c1
Sequence:CCGGGAACCGTAGAGGGTGGCTCTTCTCGAGAAGAGCCACCCTCTACGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153408
NEURL3 MISSION shRNA shRNA Plasmid DNA
neuralized homolog 3 (Drosophila) pseudogene
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153408.1-619s1c1
Sequence:CCGGCCAGAGTCTGAAGTCATATCACTCGAGTGATATGACTTCAGACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153408.1-189s1c1
Sequence:CCGGGTTCCACGATGGTATCGTGTTCTCGAGAACACGATACCATCGTGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153408.1-731s1c1
Sequence:CCGGACATCTTCAAAGACACGGCCACTCGAGTGGCCGTGTCTTTGAAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153408.1-564s1c1
Sequence:CCGGCATTGAGCTTCTGGATCCCAACTCGAGTTGGGATCCAGAAGCTCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153408.1-441s1c1
Sequence:CCGGGAACCGTAGAGGGTGGCTCTTCTCGAGAAGAGCCACCCTCTACGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153408
NEURL3 MISSION shRNA Lentiviral Transduction Particles
neuralized homolog 3 (Drosophila) pseudogene
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153408.1-619s1c1
Sequence:CCGGCCAGAGTCTGAAGTCATATCACTCGAGTGATATGACTTCAGACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153408.1-189s1c1
Sequence:CCGGGTTCCACGATGGTATCGTGTTCTCGAGAACACGATACCATCGTGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153408.1-731s1c1
Sequence:CCGGACATCTTCAAAGACACGGCCACTCGAGTGGCCGTGTCTTTGAAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153408.1-564s1c1
Sequence:CCGGCATTGAGCTTCTGGATCCCAACTCGAGTTGGGATCCAGAAGCTCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153408.1-441s1c1
Sequence:CCGGGAACCGTAGAGGGTGGCTCTTCTCGAGAAGAGCCACCCTCTACGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)